Incidental Mutation 'R4573:Cep290'
ID 342281
Institutional Source Beutler Lab
Gene Symbol Cep290
Ensembl Gene ENSMUSG00000019971
Gene Name centrosomal protein 290
Synonyms b2b1454Clo, Nphp6, b2b1752Clo
MMRRC Submission 041598-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.949) question?
Stock # R4573 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 100487558-100574840 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 100518850 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 932 (K932R)
Ref Sequence ENSEMBL: ENSMUSP00000151388 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164751] [ENSMUST00000219765] [ENSMUST00000220346]
AlphaFold Q6A078
Predicted Effect probably benign
Transcript: ENSMUST00000164751
AA Change: K932R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000130899
Gene: ENSMUSG00000019971
AA Change: K932R

DomainStartEndE-ValueType
coiled coil region 59 298 N/A INTRINSIC
coiled coil region 319 566 N/A INTRINSIC
coiled coil region 598 662 N/A INTRINSIC
coiled coil region 697 754 N/A INTRINSIC
coiled coil region 780 875 N/A INTRINSIC
internal_repeat_2 884 894 1.1e-5 PROSPERO
coiled coil region 986 1028 N/A INTRINSIC
internal_repeat_2 1057 1067 1.1e-5 PROSPERO
coiled coil region 1071 1109 N/A INTRINSIC
low complexity region 1140 1156 N/A INTRINSIC
internal_repeat_1 1176 1206 8.72e-8 PROSPERO
coiled coil region 1221 1250 N/A INTRINSIC
Pfam:CEP209_CC5 1290 1417 3.8e-55 PFAM
low complexity region 1476 1493 N/A INTRINSIC
internal_repeat_1 1498 1525 8.72e-8 PROSPERO
coiled coil region 1535 1595 N/A INTRINSIC
coiled coil region 1624 1716 N/A INTRINSIC
coiled coil region 1776 2328 N/A INTRINSIC
low complexity region 2333 2347 N/A INTRINSIC
coiled coil region 2377 2453 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000219765
AA Change: K925R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000220346
AA Change: K932R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with 13 putative coiled-coil domains, a region with homology to SMC chromosome segregation ATPases, six KID motifs, three tropomyosin homology domains and an ATP/GTP binding site motif A. The protein is localized to the centrosome and cilia and has sites for N-glycosylation, tyrosine sulfation, phosphorylation, N-myristoylation, and amidation. Mutations in this gene have been associated with Joubert syndrome and nephronophthisis and the presence of antibodies against this protein is associated with several forms of cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutant mice display mislocalization of ciliary and phototransduction proteins resulting in early-onset retinal degeneration. Heterotaxy with transposition of the great arteries (TGA), atrioventricular septal defect (AVSD), left bronchial isomerism, and hypoplastic spleen is also seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam15 T C 3: 89,345,986 E212G probably damaging Het
Adam1b A C 5: 121,500,793 S730A probably benign Het
Akr1b10 T C 6: 34,392,129 V153A probably damaging Het
Ap1m2 T C 9: 21,305,758 Y94C probably damaging Het
Arhgef33 T C 17: 80,365,282 S320P probably damaging Het
Arsg T C 11: 109,517,282 S87P probably damaging Het
Asic3 A G 5: 24,417,192 Y458C probably damaging Het
Aspm G T 1: 139,479,507 W2044L probably damaging Het
Atad2b T C 12: 4,954,663 probably null Het
Atp1a2 T C 1: 172,278,637 I869M possibly damaging Het
Bpifb2 C T 2: 153,889,492 L263F probably damaging Het
C1s2 T C 6: 124,628,243 probably null Het
Carf G T 1: 60,148,112 A590S probably benign Het
Cbarp G T 10: 80,131,411 D658E probably damaging Het
Cd1d2 A G 3: 86,987,554 I78V probably benign Het
Cdc42bpb A T 12: 111,323,141 M418K probably benign Het
Cdhr3 A T 12: 33,068,153 probably null Het
Ces1d A C 8: 93,181,534 N310K probably benign Het
Chka A G 19: 3,885,960 K240R probably damaging Het
Cltb C T 13: 54,598,761 R64H probably damaging Het
Cyp4f37 A G 17: 32,629,087 E193G probably benign Het
Dhrs9 C A 2: 69,397,641 H200N probably benign Het
Dnah6 T A 6: 73,086,181 N2698I probably damaging Het
Dnah8 T C 17: 30,700,406 S1118P probably benign Het
Dyrk1a A G 16: 94,692,023 Y705C possibly damaging Het
Elmod1 T C 9: 53,925,972 N183S probably damaging Het
Fam129a T C 1: 151,703,766 V412A possibly damaging Het
Fer1l6 G A 15: 58,626,280 probably null Het
Fsip2 A T 2: 82,986,166 Y4081F possibly damaging Het
Gm38394 A G 1: 133,659,389 I70T probably benign Het
Gsr A G 8: 33,693,853 D381G probably benign Het
Gucy1a1 A G 3: 82,108,922 L253S possibly damaging Het
Herc3 C A 6: 58,894,113 T69K possibly damaging Het
Hoxb13 A G 11: 96,194,951 Y170C probably damaging Het
Hsd3b5 T C 3: 98,619,648 M161V probably benign Het
Lrp6 G A 6: 134,470,730 R985* probably null Het
March5 T A 19: 37,220,394 I154K probably damaging Het
Mcemp1 A G 8: 3,665,835 probably null Het
Mrpl2 G T 17: 46,649,041 C212F possibly damaging Het
Mterf1a G A 5: 3,891,119 R250W possibly damaging Het
Mthfd1 A G 12: 76,294,138 probably null Het
Mul1 T C 4: 138,436,349 F19L probably benign Het
Mycbp2 G T 14: 103,346,297 A74E probably benign Het
Myo5a A T 9: 75,201,297 probably null Het
Ncor2 A T 5: 125,055,825 S33T probably damaging Het
Ninj1 A G 13: 49,194,987 N191S probably damaging Het
Nrap T C 19: 56,342,338 probably null Het
Ofcc1 G A 13: 40,015,388 T841I probably damaging Het
Olfr353 T C 2: 36,890,190 I219M probably damaging Het
Olfr50 T A 2: 36,793,479 M81K probably damaging Het
Osbpl5 C A 7: 143,694,316 V671L probably benign Het
Paics T C 5: 76,956,603 L25S probably benign Het
Pcmtd1 A G 1: 7,120,367 E20G probably damaging Het
Pgbd5 G A 8: 124,376,227 Q228* probably null Het
Pnpla7 T C 2: 25,050,873 V1079A probably damaging Het
Pou2f1 G A 1: 165,913,261 T113I probably benign Het
Ppp1r14c A G 10: 3,463,416 I150V possibly damaging Het
Ppp1r2 A G 16: 31,260,637 Y115H possibly damaging Het
Ptchd4 T C 17: 42,502,777 V523A probably benign Het
Rabep1 G C 11: 70,917,751 S468T probably damaging Het
Rgs6 T A 12: 83,066,015 W200R probably damaging Het
Ryr3 C T 2: 112,755,174 probably null Het
Scamp2 A T 9: 57,577,194 D20V probably damaging Het
Sec24d G A 3: 123,358,870 V844M probably damaging Het
Sept10 T A 10: 59,192,329 N57Y probably damaging Het
Sis T C 3: 72,928,237 K931E possibly damaging Het
Slamf7 T C 1: 171,636,366 T258A probably benign Het
Slc15a1 A G 14: 121,487,029 S144P probably damaging Het
Slc6a7 A T 18: 61,002,181 V425E probably benign Het
Syt7 C T 19: 10,439,212 R253* probably null Het
Tm4sf1 A T 3: 57,294,785 C2S possibly damaging Het
Trio CCTTCTTCTTCT CCTTCTTCT 15: 27,772,998 probably benign Het
Trpm3 C T 19: 22,902,142 H594Y probably damaging Het
Tshz1 A T 18: 84,015,082 N400K probably damaging Het
Vat1 A T 11: 101,460,615 M300K probably benign Het
Vmn1r70 C A 7: 10,633,629 probably null Het
Vmn2r5 C T 3: 64,503,918 D410N probably damaging Het
Yap1 T C 9: 7,934,681 D428G probably damaging Het
Zfp157 A G 5: 138,456,929 Y463C probably damaging Het
Other mutations in Cep290
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Cep290 APN 10 100508724 missense probably benign 0.00
IGL00499:Cep290 APN 10 100543327 missense probably damaging 1.00
IGL00547:Cep290 APN 10 100510708 missense probably damaging 0.99
IGL00573:Cep290 APN 10 100540361 missense probably damaging 1.00
IGL00646:Cep290 APN 10 100501154 missense probably benign 0.15
IGL00755:Cep290 APN 10 100531104 missense probably damaging 1.00
IGL00835:Cep290 APN 10 100563380 nonsense probably null
IGL00846:Cep290 APN 10 100540333 splice site probably benign
IGL00985:Cep290 APN 10 100567161 splice site probably benign
IGL01687:Cep290 APN 10 100500205 missense probably damaging 1.00
IGL01782:Cep290 APN 10 100545125 nonsense probably null
IGL02010:Cep290 APN 10 100508707 missense probably benign 0.39
IGL02010:Cep290 APN 10 100561345 missense probably benign 0.00
IGL02036:Cep290 APN 10 100558100 nonsense probably null
IGL02039:Cep290 APN 10 100514602 critical splice donor site probably null
IGL02532:Cep290 APN 10 100545065 missense probably benign 0.04
IGL02950:Cep290 APN 10 100540329 splice site probably benign
IGL03105:Cep290 APN 10 100551824 missense possibly damaging 0.66
IGL03179:Cep290 APN 10 100568088 missense possibly damaging 0.60
IGL03271:Cep290 APN 10 100537801 missense probably benign 0.09
IGL03401:Cep290 APN 10 100500265 missense probably benign 0.27
PIT4687001:Cep290 UTSW 10 100537591 missense probably benign 0.28
R0025:Cep290 UTSW 10 100537831 missense probably damaging 1.00
R0127:Cep290 UTSW 10 100536925 splice site probably benign
R0254:Cep290 UTSW 10 100514574 missense probably benign 0.31
R0295:Cep290 UTSW 10 100537821 missense probably damaging 0.99
R0371:Cep290 UTSW 10 100518564 splice site probably benign
R0390:Cep290 UTSW 10 100508758 missense probably benign 0.09
R0399:Cep290 UTSW 10 100554400 splice site probably benign
R0413:Cep290 UTSW 10 100523314 nonsense probably null
R0427:Cep290 UTSW 10 100516179 missense probably benign 0.01
R0472:Cep290 UTSW 10 100551455 missense probably benign 0.19
R0485:Cep290 UTSW 10 100549344 missense possibly damaging 0.94
R0635:Cep290 UTSW 10 100492676 missense probably damaging 1.00
R0675:Cep290 UTSW 10 100568813 critical splice acceptor site probably null
R0972:Cep290 UTSW 10 100518762 missense probably benign 0.08
R1238:Cep290 UTSW 10 100517863 missense probably damaging 1.00
R1297:Cep290 UTSW 10 100539100 splice site probably benign
R1368:Cep290 UTSW 10 100494966 splice site probably benign
R1394:Cep290 UTSW 10 100537529 missense possibly damaging 0.66
R1437:Cep290 UTSW 10 100572101 missense probably benign 0.00
R1493:Cep290 UTSW 10 100562181 missense probably benign 0.21
R1496:Cep290 UTSW 10 100538966 missense probably damaging 1.00
R1539:Cep290 UTSW 10 100496828 missense probably benign 0.06
R1598:Cep290 UTSW 10 100549329 missense probably damaging 1.00
R1616:Cep290 UTSW 10 100568836 missense probably benign
R1712:Cep290 UTSW 10 100554499 missense probably benign 0.02
R1753:Cep290 UTSW 10 100513981 missense probably benign
R1773:Cep290 UTSW 10 100510573 missense probably benign
R1775:Cep290 UTSW 10 100496810 missense probably damaging 0.98
R1799:Cep290 UTSW 10 100516196 missense probably benign 0.00
R1937:Cep290 UTSW 10 100497953 missense possibly damaging 0.71
R1991:Cep290 UTSW 10 100531184 missense possibly damaging 0.80
R2031:Cep290 UTSW 10 100512400 critical splice donor site probably null
R2164:Cep290 UTSW 10 100518795 missense probably damaging 0.96
R2393:Cep290 UTSW 10 100561238 critical splice acceptor site probably null
R2403:Cep290 UTSW 10 100537437 missense probably benign 0.19
R3612:Cep290 UTSW 10 100541581 nonsense probably null
R3800:Cep290 UTSW 10 100572941 missense probably damaging 0.97
R4005:Cep290 UTSW 10 100539008 missense probably damaging 1.00
R4039:Cep290 UTSW 10 100512401 critical splice donor site probably null
R4259:Cep290 UTSW 10 100514492 missense probably damaging 1.00
R4260:Cep290 UTSW 10 100514492 missense probably damaging 1.00
R4319:Cep290 UTSW 10 100539047 missense probably benign 0.09
R4329:Cep290 UTSW 10 100537668 missense probably damaging 0.98
R4614:Cep290 UTSW 10 100508740 missense probably benign
R4614:Cep290 UTSW 10 100559687 missense possibly damaging 0.93
R4708:Cep290 UTSW 10 100523264 missense probably benign 0.02
R4727:Cep290 UTSW 10 100563270 missense probably benign 0.05
R4825:Cep290 UTSW 10 100488348 missense probably damaging 0.96
R4839:Cep290 UTSW 10 100508786 missense probably damaging 0.99
R4858:Cep290 UTSW 10 100494911 missense probably benign 0.31
R4871:Cep290 UTSW 10 100548914 missense probably benign 0.22
R5094:Cep290 UTSW 10 100567030 missense probably damaging 0.97
R5103:Cep290 UTSW 10 100539020 missense probably damaging 1.00
R5499:Cep290 UTSW 10 100537653 missense probably damaging 0.99
R5505:Cep290 UTSW 10 100499186 critical splice donor site probably null
R5615:Cep290 UTSW 10 100531150 missense probably damaging 1.00
R5815:Cep290 UTSW 10 100558108 missense possibly damaging 0.80
R5883:Cep290 UTSW 10 100523399 missense probably benign 0.44
R5889:Cep290 UTSW 10 100499074 missense possibly damaging 0.95
R5928:Cep290 UTSW 10 100551830 missense probably damaging 0.99
R5992:Cep290 UTSW 10 100543321 missense possibly damaging 0.73
R6000:Cep290 UTSW 10 100541787 missense probably damaging 1.00
R6213:Cep290 UTSW 10 100523360 missense probably benign 0.06
R6274:Cep290 UTSW 10 100530207 missense probably damaging 1.00
R6285:Cep290 UTSW 10 100523329 missense probably benign 0.17
R6306:Cep290 UTSW 10 100531166 missense possibly damaging 0.89
R6593:Cep290 UTSW 10 100508776 missense probably benign 0.01
R6649:Cep290 UTSW 10 100518531 missense probably benign 0.28
R6692:Cep290 UTSW 10 100569144 splice site probably null
R6788:Cep290 UTSW 10 100488628 missense probably damaging 1.00
R6847:Cep290 UTSW 10 100563419 missense probably damaging 1.00
R6947:Cep290 UTSW 10 100530056 missense probably damaging 1.00
R7035:Cep290 UTSW 10 100499071 missense probably benign 0.07
R7073:Cep290 UTSW 10 100539003 missense possibly damaging 0.90
R7114:Cep290 UTSW 10 100543358 missense probably damaging 0.98
R7256:Cep290 UTSW 10 100546498 missense probably damaging 1.00
R7258:Cep290 UTSW 10 100499108 missense probably benign 0.01
R7311:Cep290 UTSW 10 100537718 missense probably damaging 0.98
R7505:Cep290 UTSW 10 100516265 missense probably benign 0.01
R7615:Cep290 UTSW 10 100492681 missense probably benign 0.03
R7643:Cep290 UTSW 10 100537553 missense probably benign
R7662:Cep290 UTSW 10 100537803 missense probably benign 0.21
R7663:Cep290 UTSW 10 100554536 critical splice donor site probably null
R7685:Cep290 UTSW 10 100540057 missense probably benign 0.19
R7699:Cep290 UTSW 10 100540369 missense probably benign 0.33
R7717:Cep290 UTSW 10 100492681 missense probably benign 0.03
R7747:Cep290 UTSW 10 100558176 nonsense probably null
R7757:Cep290 UTSW 10 100563434 missense probably benign
R7843:Cep290 UTSW 10 100516188 missense possibly damaging 0.49
R7905:Cep290 UTSW 10 100554490 missense probably benign
R8078:Cep290 UTSW 10 100572887 missense probably benign 0.04
R8081:Cep290 UTSW 10 100558176 nonsense probably null
R8094:Cep290 UTSW 10 100544931 missense possibly damaging 0.95
R8266:Cep290 UTSW 10 100559671 missense probably benign 0.08
R8305:Cep290 UTSW 10 100544934 missense probably benign 0.09
R8325:Cep290 UTSW 10 100517808 missense probably benign 0.03
R8372:Cep290 UTSW 10 100549341 missense probably benign 0.00
R8443:Cep290 UTSW 10 100495844 missense possibly damaging 0.80
R8497:Cep290 UTSW 10 100551458 missense probably damaging 1.00
R8778:Cep290 UTSW 10 100514512 nonsense probably null
R8975:Cep290 UTSW 10 100513920 missense possibly damaging 0.54
R9146:Cep290 UTSW 10 100541803 missense probably benign 0.44
R9264:Cep290 UTSW 10 100498016 missense possibly damaging 0.86
R9374:Cep290 UTSW 10 100536867 missense probably damaging 0.98
R9448:Cep290 UTSW 10 100559684 missense probably benign 0.32
R9499:Cep290 UTSW 10 100536867 missense probably damaging 0.98
R9507:Cep290 UTSW 10 100494923 missense possibly damaging 0.81
R9539:Cep290 UTSW 10 100568851 missense probably damaging 1.00
R9547:Cep290 UTSW 10 100544979 missense probably benign 0.00
R9551:Cep290 UTSW 10 100536867 missense probably damaging 0.98
R9657:Cep290 UTSW 10 100515141 missense possibly damaging 0.93
R9731:Cep290 UTSW 10 100510542 missense probably damaging 0.98
R9756:Cep290 UTSW 10 100516172 missense probably damaging 0.97
R9777:Cep290 UTSW 10 100518667 missense probably benign 0.01
Z1176:Cep290 UTSW 10 100549374 critical splice donor site probably benign
Z1177:Cep290 UTSW 10 100497944 missense probably benign
Z1177:Cep290 UTSW 10 100538997 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TGCTCTTCAGATGGATTCGAAC -3'
(R):5'- GCTTTCCATTGTAGAGATGTACAC -3'

Sequencing Primer
(F):5'- CTCTTCAGATGGATTCGAACGAGATG -3'
(R):5'- CATTAACCGTTAGCCCTG -3'
Posted On 2015-09-24