Mutagenetix > Incidental Mutation

Incidental Mutation 'R4573:Slc15a1'

342293

Institutional Source

Beutler Lab

Gene Symbol

Slc15a1

Ensembl Gene

ENSMUSG00000025557

Gene Name

solute carrier family 15 (oligopeptide transporter), member 1

Synonyms

PECT1, PEPT1

MMRRC Submission

041598-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.057) question?

Stock #

R4573 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

121459621-121505252 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 121487029 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 144 (S144P)

Ref Sequence

ENSEMBL: ENSMUSP00000085728 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000088386]

AlphaFold

Q9JIP7

Predicted Effect

probably damaging
Transcript: ENSMUST00000088386
AA Change: S144P

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000085728
Gene: ENSMUSG00000025557
AA Change: S144P

Domain	Start	End	E-Value	Type
Pfam:PTR2	81	477	1.9e-141	PFAM
Pfam:PTR2	562	644	4.2e-11	PFAM
transmembrane domain	650	672	N/A	INTRINSIC
low complexity region	684	695	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227372

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an intestinal hydrogen peptide cotransporter that is a member of the solute carrier family 15. The encoded protein is localized to the brush border membrane of the intestinal epithelium and mediates the uptake of di- and tripeptides from the lumen into the enterocytes. This protein plays an important role in the uptake and digestion of dietary proteins. This protein also facilitates the absorption of numerous peptidomimetic drugs. [provided by RefSeq, Apr 2010]
PHENOTYPE: Peptide uptake in the intestine is substantially reduced in mice homozygous for a null mutation of this gene. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam15	T	C	3: 89,345,986	E212G	probably damaging	Het
Adam1b	A	C	5: 121,500,793	S730A	probably benign	Het
Akr1b10	T	C	6: 34,392,129	V153A	probably damaging	Het
Ap1m2	T	C	9: 21,305,758	Y94C	probably damaging	Het
Arhgef33	T	C	17: 80,365,282	S320P	probably damaging	Het
Arsg	T	C	11: 109,517,282	S87P	probably damaging	Het
Asic3	A	G	5: 24,417,192	Y458C	probably damaging	Het
Aspm	G	T	1: 139,479,507	W2044L	probably damaging	Het
Atad2b	T	C	12: 4,954,663		probably null	Het
Atp1a2	T	C	1: 172,278,637	I869M	possibly damaging	Het
Bpifb2	C	T	2: 153,889,492	L263F	probably damaging	Het
C1s2	T	C	6: 124,628,243		probably null	Het
Carf	G	T	1: 60,148,112	A590S	probably benign	Het
Cbarp	G	T	10: 80,131,411	D658E	probably damaging	Het
Cd1d2	A	G	3: 86,987,554	I78V	probably benign	Het
Cdc42bpb	A	T	12: 111,323,141	M418K	probably benign	Het
Cdhr3	A	T	12: 33,068,153		probably null	Het
Cep290	A	G	10: 100,518,850	K932R	probably benign	Het
Ces1d	A	C	8: 93,181,534	N310K	probably benign	Het
Chka	A	G	19: 3,885,960	K240R	probably damaging	Het
Cltb	C	T	13: 54,598,761	R64H	probably damaging	Het
Cyp4f37	A	G	17: 32,629,087	E193G	probably benign	Het
Dhrs9	C	A	2: 69,397,641	H200N	probably benign	Het
Dnah6	T	A	6: 73,086,181	N2698I	probably damaging	Het
Dnah8	T	C	17: 30,700,406	S1118P	probably benign	Het
Dyrk1a	A	G	16: 94,692,023	Y705C	possibly damaging	Het
Elmod1	T	C	9: 53,925,972	N183S	probably damaging	Het
Fam129a	T	C	1: 151,703,766	V412A	possibly damaging	Het
Fer1l6	G	A	15: 58,626,280		probably null	Het
Fsip2	A	T	2: 82,986,166	Y4081F	possibly damaging	Het
Gm38394	A	G	1: 133,659,389	I70T	probably benign	Het
Gsr	A	G	8: 33,693,853	D381G	probably benign	Het
Gucy1a1	A	G	3: 82,108,922	L253S	possibly damaging	Het
Herc3	C	A	6: 58,894,113	T69K	possibly damaging	Het
Hoxb13	A	G	11: 96,194,951	Y170C	probably damaging	Het
Hsd3b5	T	C	3: 98,619,648	M161V	probably benign	Het
Lrp6	G	A	6: 134,470,730	R985*	probably null	Het
March5	T	A	19: 37,220,394	I154K	probably damaging	Het
Mcemp1	A	G	8: 3,665,835		probably null	Het
Mrpl2	G	T	17: 46,649,041	C212F	possibly damaging	Het
Mterf1a	G	A	5: 3,891,119	R250W	possibly damaging	Het
Mthfd1	A	G	12: 76,294,138		probably null	Het
Mul1	T	C	4: 138,436,349	F19L	probably benign	Het
Mycbp2	G	T	14: 103,346,297	A74E	probably benign	Het
Myo5a	A	T	9: 75,201,297		probably null	Het
Ncor2	A	T	5: 125,055,825	S33T	probably damaging	Het
Ninj1	A	G	13: 49,194,987	N191S	probably damaging	Het
Nrap	T	C	19: 56,342,338		probably null	Het
Ofcc1	G	A	13: 40,015,388	T841I	probably damaging	Het
Olfr353	T	C	2: 36,890,190	I219M	probably damaging	Het
Olfr50	T	A	2: 36,793,479	M81K	probably damaging	Het
Osbpl5	C	A	7: 143,694,316	V671L	probably benign	Het
Paics	T	C	5: 76,956,603	L25S	probably benign	Het
Pcmtd1	A	G	1: 7,120,367	E20G	probably damaging	Het
Pgbd5	G	A	8: 124,376,227	Q228*	probably null	Het
Pnpla7	T	C	2: 25,050,873	V1079A	probably damaging	Het
Pou2f1	G	A	1: 165,913,261	T113I	probably benign	Het
Ppp1r14c	A	G	10: 3,463,416	I150V	possibly damaging	Het
Ppp1r2	A	G	16: 31,260,637	Y115H	possibly damaging	Het
Ptchd4	T	C	17: 42,502,777	V523A	probably benign	Het
Rabep1	G	C	11: 70,917,751	S468T	probably damaging	Het
Rgs6	T	A	12: 83,066,015	W200R	probably damaging	Het
Ryr3	C	T	2: 112,755,174		probably null	Het
Scamp2	A	T	9: 57,577,194	D20V	probably damaging	Het
Sec24d	G	A	3: 123,358,870	V844M	probably damaging	Het
Sept10	T	A	10: 59,192,329	N57Y	probably damaging	Het
Sis	T	C	3: 72,928,237	K931E	possibly damaging	Het
Slamf7	T	C	1: 171,636,366	T258A	probably benign	Het
Slc6a7	A	T	18: 61,002,181	V425E	probably benign	Het
Syt7	C	T	19: 10,439,212	R253*	probably null	Het
Tm4sf1	A	T	3: 57,294,785	C2S	possibly damaging	Het
Trio	CCTTCTTCTTCT	CCTTCTTCT	15: 27,772,998		probably benign	Het
Trpm3	C	T	19: 22,902,142	H594Y	probably damaging	Het
Tshz1	A	T	18: 84,015,082	N400K	probably damaging	Het
Vat1	A	T	11: 101,460,615	M300K	probably benign	Het
Vmn1r70	C	A	7: 10,633,629		probably null	Het
Vmn2r5	C	T	3: 64,503,918	D410N	probably damaging	Het
Yap1	T	C	9: 7,934,681	D428G	probably damaging	Het
Zfp157	A	G	5: 138,456,929	Y463C	probably damaging	Het

Other mutations in Slc15a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01337:Slc15a1	APN	14	121460679	missense	possibly damaging	0.95
IGL01534:Slc15a1	APN	14	121464952	missense	possibly damaging	0.95
IGL01783:Slc15a1	APN	14	121471276	critical splice donor site	probably null
IGL01799:Slc15a1	APN	14	121480729	missense	possibly damaging	0.76
IGL02064:Slc15a1	APN	14	121462499	missense	possibly damaging	0.66
IGL02064:Slc15a1	APN	14	121462474	missense	probably benign	0.20
IGL02115:Slc15a1	APN	14	121480661	missense	possibly damaging	0.61
IGL02514:Slc15a1	APN	14	121487040	missense	probably damaging	1.00
IGL03056:Slc15a1	APN	14	121491283	missense	possibly damaging	0.82
IGL03297:Slc15a1	APN	14	121486684	missense	probably damaging	1.00
R1484:Slc15a1	UTSW	14	121491239	nonsense	probably null
R1532:Slc15a1	UTSW	14	121475984	missense	possibly damaging	0.79
R1655:Slc15a1	UTSW	14	121465899	missense	probably benign	0.34
R2013:Slc15a1	UTSW	14	121475987	missense	possibly damaging	0.88
R2270:Slc15a1	UTSW	14	121479994	missense	probably damaging	0.99
R2878:Slc15a1	UTSW	14	121465933	missense	probably benign	0.00
R2986:Slc15a1	UTSW	14	121489809	missense	probably benign	0.02
R3862:Slc15a1	UTSW	14	121484857	missense	probably benign	0.06
R3863:Slc15a1	UTSW	14	121484857	missense	probably benign	0.06
R3978:Slc15a1	UTSW	14	121489827	missense	probably benign	0.00
R4184:Slc15a1	UTSW	14	121466162	missense	probably benign	0.00
R4604:Slc15a1	UTSW	14	121489907	missense	probably damaging	1.00
R4649:Slc15a1	UTSW	14	121478092	missense	probably damaging	1.00
R5838:Slc15a1	UTSW	14	121484871	missense	probably damaging	1.00
R6221:Slc15a1	UTSW	14	121464904	missense	probably null	1.00
R6891:Slc15a1	UTSW	14	121476030	missense	probably benign	0.00
R7626:Slc15a1	UTSW	14	121475965	missense	probably benign	0.13
R7836:Slc15a1	UTSW	14	121480733	nonsense	probably null
R8284:Slc15a1	UTSW	14	121489863	missense	probably benign	0.01
R8376:Slc15a1	UTSW	14	121480703	missense	probably benign
R8408:Slc15a1	UTSW	14	121478116	missense	possibly damaging	0.91
R8774:Slc15a1	UTSW	14	121487011	missense	probably damaging	1.00
R8774-TAIL:Slc15a1	UTSW	14	121487011	missense	probably damaging	1.00
R8933:Slc15a1	UTSW	14	121486679	missense	probably benign	0.00
R9157:Slc15a1	UTSW	14	121464977	missense	probably benign	0.08
Z1088:Slc15a1	UTSW	14	121480054	missense	probably benign	0.09
Z1088:Slc15a1	UTSW	14	121491044	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTTTCAAGCATTCTGGGAAAGAC -3'
(R):5'- CATTCAATGCCCAGCCTGTC -3'

Sequencing Primer
(F):5'- CTAGGAGTGAGACAGAGCTCGC -3'
(R):5'- TCCGTGAGAGAACCTCCATG -3'

Posted On

2015-09-24