Mutagenetix > Incidental Mutations

Incidental Mutation 'R4573:Trio'

342294

Institutional Source

Beutler Lab

Gene Symbol

Trio

Ensembl Gene

ENSMUSG00000022263

Gene Name

triple functional domain (PTPRF interacting)

Synonyms

Solo, 6720464I07Rik

MMRRC Submission

041598-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4573 (G1)

Quality Score

217

Status

Not validated

Chromosome

Chromosomal Location

27730651-28025848 bp(-) (GRCm38)

Type of Mutation

small deletion (1 aa in frame mutation)

DNA Base Change (assembly)

CCTTCTTCTTCT to CCTTCTTCT at 27772998 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000154653 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090247] [ENSMUST00000226287] [ENSMUST00000226644] [ENSMUST00000227337]

Predicted Effect

probably benign
Transcript: ENSMUST00000090247

SMART Domains

Protein: ENSMUSP00000087714
Gene: ENSMUSG00000022263

Domain	Start	End	E-Value	Type
low complexity region	2	40	N/A	INTRINSIC
SEC14	68	207	3.4e-26	SMART
SPEC	221	337	2.48e-9	SMART
SPEC	343	445	1.92e-15	SMART
SPEC	569	671	5.35e-14	SMART
SPEC	674	783	1.18e-6	SMART
SPEC	910	1011	2.6e-12	SMART
SPEC	1141	1243	7e-18	SMART
low complexity region	1249	1258	N/A	INTRINSIC
RhoGEF	1296	1466	2.79e-53	SMART
PH	1480	1593	1.53e-9	SMART
SH3	1659	1720	1.9e-8	SMART
low complexity region	1788	1802	N/A	INTRINSIC
low complexity region	1837	1863	N/A	INTRINSIC
low complexity region	1936	1954	N/A	INTRINSIC
RhoGEF	1973	2144	1.32e-63	SMART
PH	2158	2273	3.6e-6	SMART
low complexity region	2291	2341	N/A	INTRINSIC
low complexity region	2371	2390	N/A	INTRINSIC
low complexity region	2491	2503	N/A	INTRINSIC
SH3	2558	2619	1.04e0	SMART
low complexity region	2640	2660	N/A	INTRINSIC
IGc2	2701	2770	4e-12	SMART
S_TKc	2800	3054	4.84e-72	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000226287

Predicted Effect

probably benign
Transcript: ENSMUST00000226644

Predicted Effect

probably benign
Transcript: ENSMUST00000227337

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large protein that functions as a GDP to GTP exchange factor. This protein promotes the reorganization of the actin cytoskeleton, thereby playing a role in cell migration and growth. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous mutant mice die during late embryonic development or shortly after birth. They exhibit abnormal skeletal myogenesis and display aberrant organization within the hippocampus and olfactory bulb. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam15	T	C	3: 89,345,986	E212G	probably damaging	Het
Adam1b	A	C	5: 121,500,793	S730A	probably benign	Het
Akr1b10	T	C	6: 34,392,129	V153A	probably damaging	Het
Ap1m2	T	C	9: 21,305,758	Y94C	probably damaging	Het
Arhgef33	T	C	17: 80,365,282	S320P	probably damaging	Het
Arsg	T	C	11: 109,517,282	S87P	probably damaging	Het
Asic3	A	G	5: 24,417,192	Y458C	probably damaging	Het
Aspm	G	T	1: 139,479,507	W2044L	probably damaging	Het
Atad2b	T	C	12: 4,954,663		probably null	Het
Atp1a2	T	C	1: 172,278,637	I869M	possibly damaging	Het
Bpifb2	C	T	2: 153,889,492	L263F	probably damaging	Het
C1s2	T	C	6: 124,628,243		probably null	Het
Carf	G	T	1: 60,148,112	A590S	probably benign	Het
Cbarp	G	T	10: 80,131,411	D658E	probably damaging	Het
Cd1d2	A	G	3: 86,987,554	I78V	probably benign	Het
Cdc42bpb	A	T	12: 111,323,141	M418K	probably benign	Het
Cdhr3	A	T	12: 33,068,153		probably null	Het
Cep290	A	G	10: 100,518,850	K932R	probably benign	Het
Ces1d	A	C	8: 93,181,534	N310K	probably benign	Het
Chka	A	G	19: 3,885,960	K240R	probably damaging	Het
Cltb	C	T	13: 54,598,761	R64H	probably damaging	Het
Cyp4f37	A	G	17: 32,629,087	E193G	probably benign	Het
Dhrs9	C	A	2: 69,397,641	H200N	probably benign	Het
Dnah6	T	A	6: 73,086,181	N2698I	probably damaging	Het
Dnah8	T	C	17: 30,700,406	S1118P	probably benign	Het
Dyrk1a	A	G	16: 94,692,023	Y705C	possibly damaging	Het
Elmod1	T	C	9: 53,925,972	N183S	probably damaging	Het
Fam129a	T	C	1: 151,703,766	V412A	possibly damaging	Het
Fer1l6	G	A	15: 58,626,280		probably null	Het
Fsip2	A	T	2: 82,986,166	Y4081F	possibly damaging	Het
Gm38394	A	G	1: 133,659,389	I70T	probably benign	Het
Gsr	A	G	8: 33,693,853	D381G	probably benign	Het
Gucy1a1	A	G	3: 82,108,922	L253S	possibly damaging	Het
Herc3	C	A	6: 58,894,113	T69K	possibly damaging	Het
Hoxb13	A	G	11: 96,194,951	Y170C	probably damaging	Het
Hsd3b5	T	C	3: 98,619,648	M161V	probably benign	Het
Lrp6	G	A	6: 134,470,730	R985*	probably null	Het
March5	T	A	19: 37,220,394	I154K	probably damaging	Het
Mcemp1	A	G	8: 3,665,835		probably null	Het
Mrpl2	G	T	17: 46,649,041	C212F	possibly damaging	Het
Mterf1a	G	A	5: 3,891,119	R250W	possibly damaging	Het
Mthfd1	A	G	12: 76,294,138		probably null	Het
Mul1	T	C	4: 138,436,349	F19L	probably benign	Het
Mycbp2	G	T	14: 103,346,297	A74E	probably benign	Het
Myo5a	A	T	9: 75,201,297		probably null	Het
Ncor2	A	T	5: 125,055,825	S33T	probably damaging	Het
Ninj1	A	G	13: 49,194,987	N191S	probably damaging	Het
Nrap	T	C	19: 56,342,338		probably null	Het
Ofcc1	G	A	13: 40,015,388	T841I	probably damaging	Het
Olfr353	T	C	2: 36,890,190	I219M	probably damaging	Het
Olfr50	T	A	2: 36,793,479	M81K	probably damaging	Het
Osbpl5	C	A	7: 143,694,316	V671L	probably benign	Het
Paics	T	C	5: 76,956,603	L25S	probably benign	Het
Pcmtd1	A	G	1: 7,120,367	E20G	probably damaging	Het
Pgbd5	G	A	8: 124,376,227	Q228*	probably null	Het
Pnpla7	T	C	2: 25,050,873	V1079A	probably damaging	Het
Pou2f1	G	A	1: 165,913,261	T113I	probably benign	Het
Ppp1r14c	A	G	10: 3,463,416	I150V	possibly damaging	Het
Ppp1r2	A	G	16: 31,260,637	Y115H	possibly damaging	Het
Ptchd4	T	C	17: 42,502,777	V523A	probably benign	Het
Rabep1	G	C	11: 70,917,751	S468T	probably damaging	Het
Rgs6	T	A	12: 83,066,015	W200R	probably damaging	Het
Ryr3	C	T	2: 112,755,174		probably null	Het
Scamp2	A	T	9: 57,577,194	D20V	probably damaging	Het
Sec24d	G	A	3: 123,358,870	V844M	probably damaging	Het
Sept10	T	A	10: 59,192,329	N57Y	probably damaging	Het
Sis	T	C	3: 72,928,237	K931E	possibly damaging	Het
Slamf7	T	C	1: 171,636,366	T258A	probably benign	Het
Slc15a1	A	G	14: 121,487,029	S144P	probably damaging	Het
Slc6a7	A	T	18: 61,002,181	V425E	probably benign	Het
Syt7	C	T	19: 10,439,212	R253*	probably null	Het
Tm4sf1	A	T	3: 57,294,785	C2S	possibly damaging	Het
Trpm3	C	T	19: 22,902,142	H594Y	probably damaging	Het
Tshz1	A	T	18: 84,015,082	N400K	probably damaging	Het
Vat1	A	T	11: 101,460,615	M300K	probably benign	Het
Vmn1r70	C	A	7: 10,633,629		probably null	Het
Vmn2r5	C	T	3: 64,503,918	D410N	probably damaging	Het
Yap1	T	C	9: 7,934,681	D428G	probably damaging	Het
Zfp157	A	G	5: 138,456,929	Y463C	probably damaging	Het

Other mutations in Trio

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00480:Trio	APN	15	27912743	splice site	probably benign
IGL01011:Trio	APN	15	27736489	missense	probably damaging	0.96
IGL01090:Trio	APN	15	27773007	missense	probably damaging	1.00
IGL01145:Trio	APN	15	27818167	splice site	probably benign
IGL01147:Trio	APN	15	27881320	missense	probably damaging	1.00
IGL01161:Trio	APN	15	27749781	missense	probably damaging	1.00
IGL01324:Trio	APN	15	27905323	missense	probably benign	0.42
IGL01352:Trio	APN	15	27901229	missense	probably benign	0.01
IGL01366:Trio	APN	15	27732868	missense	possibly damaging	0.76
IGL01443:Trio	APN	15	27838775	splice site	probably benign
IGL01454:Trio	APN	15	27832985	missense	probably benign	0.32
IGL01695:Trio	APN	15	27773001	missense	probably damaging	1.00
IGL01765:Trio	APN	15	27764026	missense	possibly damaging	0.85
IGL01860:Trio	APN	15	27846810	missense	probably damaging	1.00
IGL01879:Trio	APN	15	27741033	missense	probably benign	0.12
IGL01991:Trio	APN	15	27871274	missense	possibly damaging	0.95
IGL02106:Trio	APN	15	27744158	missense	possibly damaging	0.85
IGL02209:Trio	APN	15	27744053	missense	probably damaging	1.00
IGL02232:Trio	APN	15	27902561	missense	probably benign	0.24
IGL02304:Trio	APN	15	27735436	missense	probably damaging	0.96
IGL02504:Trio	APN	15	27847390	nonsense	probably null
IGL02508:Trio	APN	15	27818104	missense	possibly damaging	0.65
IGL02541:Trio	APN	15	27844930	splice site	probably benign
IGL02617:Trio	APN	15	27841849	splice site	probably benign
IGL02675:Trio	APN	15	27768039	unclassified	probably benign
IGL02817:Trio	APN	15	27902881	missense	probably benign	0.01
IGL02993:Trio	APN	15	27830239	splice site	probably benign
IGL03007:Trio	APN	15	27902742	missense	probably damaging	0.99
IGL03135:Trio	APN	15	27832011	splice site	probably benign
IGL03225:Trio	APN	15	27902695	missense	probably benign	0.30
R0063:Trio	UTSW	15	27881437	splice site	probably benign
R0063:Trio	UTSW	15	27881437	splice site	probably benign
R0302:Trio	UTSW	15	27902517	missense	probably damaging	1.00
R0505:Trio	UTSW	15	27767907	missense	probably benign	0.00
R0506:Trio	UTSW	15	27854963	missense	probably benign	0.12
R0564:Trio	UTSW	15	27805822	missense	probably damaging	1.00
R0659:Trio	UTSW	15	27831399	missense	probably damaging	0.97
R0882:Trio	UTSW	15	27732894	missense	probably damaging	1.00
R0939:Trio	UTSW	15	27741250	critical splice donor site	probably null
R1018:Trio	UTSW	15	27871171	missense	probably damaging	1.00
R1439:Trio	UTSW	15	27897914	missense	probably damaging	1.00
R1456:Trio	UTSW	15	27753804	splice site	probably benign
R1488:Trio	UTSW	15	27740967	missense	probably damaging	1.00
R1522:Trio	UTSW	15	27732640	missense	probably benign	0.28
R1531:Trio	UTSW	15	27832985	missense	probably benign	0.32
R1640:Trio	UTSW	15	27833044	missense	probably damaging	1.00
R1646:Trio	UTSW	15	27758347	missense	possibly damaging	0.91
R1682:Trio	UTSW	15	27744146	splice site	probably null
R1780:Trio	UTSW	15	27744038	missense	possibly damaging	0.93
R1791:Trio	UTSW	15	27841756	missense	probably damaging	1.00
R1803:Trio	UTSW	15	27748340	missense	probably benign
R1817:Trio	UTSW	15	27742495	nonsense	probably null
R1853:Trio	UTSW	15	27756536	missense	probably damaging	1.00
R1898:Trio	UTSW	15	27742380	missense	possibly damaging	0.52
R1937:Trio	UTSW	15	27833056	missense	probably damaging	1.00
R1938:Trio	UTSW	15	27732891	missense	probably damaging	0.98
R2025:Trio	UTSW	15	27744137	missense	probably damaging	0.99
R2025:Trio	UTSW	15	27773927	missense	probably damaging	1.00
R2050:Trio	UTSW	15	27851945	missense	possibly damaging	0.85
R2186:Trio	UTSW	15	27823975	splice site	probably null
R2913:Trio	UTSW	15	27854912	missense	probably damaging	1.00
R3151:Trio	UTSW	15	27805776	missense	probably damaging	1.00
R3771:Trio	UTSW	15	27748091	missense	probably damaging	0.98
R3773:Trio	UTSW	15	27748091	missense	probably damaging	0.98
R3826:Trio	UTSW	15	27833070	missense	probably damaging	1.00
R4015:Trio	UTSW	15	27744101	missense	possibly damaging	0.71
R4359:Trio	UTSW	15	27749797	nonsense	probably null
R4370:Trio	UTSW	15	27748337	nonsense	probably null
R4547:Trio	UTSW	15	27818982	missense	possibly damaging	0.89
R4620:Trio	UTSW	15	27871171	missense	probably damaging	1.00
R4735:Trio	UTSW	15	27752789	splice site	probably null
R4764:Trio	UTSW	15	27732538	nonsense	probably null
R4775:Trio	UTSW	15	27881342	nonsense	probably null
R4942:Trio	UTSW	15	27752725	missense	probably benign	0.21
R5004:Trio	UTSW	15	27755178	missense	probably damaging	1.00
R5149:Trio	UTSW	15	27754029	missense	possibly damaging	0.74
R5183:Trio	UTSW	15	27902600	missense	probably benign	0.00
R5186:Trio	UTSW	15	27897991	missense	probably damaging	0.97
R5268:Trio	UTSW	15	27748286	missense	probably benign	0.02
R5344:Trio	UTSW	15	27735532	missense	probably benign	0.12
R5407:Trio	UTSW	15	27844806	splice site	probably null
R5442:Trio	UTSW	15	27856194	missense	probably benign	0.04
R5617:Trio	UTSW	15	27902748	missense	probably benign
R5778:Trio	UTSW	15	27856164	missense	probably benign	0.33
R5986:Trio	UTSW	15	27851933	missense	possibly damaging	0.88
R5990:Trio	UTSW	15	27891459	missense	probably benign	0.10
R6011:Trio	UTSW	15	27735545	missense	probably damaging	0.98
R6063:Trio	UTSW	15	27891379	missense	possibly damaging	0.94
R6166:Trio	UTSW	15	27818071	missense	probably damaging	0.96
R6187:Trio	UTSW	15	27743952	critical splice donor site	probably null
R6387:Trio	UTSW	15	27752739	missense	probably damaging	1.00
R6402:Trio	UTSW	15	27902911	missense	probably benign	0.02
R6478:Trio	UTSW	15	27856107	missense	probably benign	0.01
R6528:Trio	UTSW	15	27805870	missense	probably damaging	1.00
R6662:Trio	UTSW	15	27854996	missense	probably benign	0.00
R6825:Trio	UTSW	15	27889308	missense	probably damaging	0.98
R6890:Trio	UTSW	15	27919288	unclassified	probably benign
R6945:Trio	UTSW	15	27824090	missense	probably damaging	1.00
R7027:Trio	UTSW	15	27805654	missense	possibly damaging	0.86
R7046:Trio	UTSW	15	27832051	missense	probably damaging	1.00
R7049:Trio	UTSW	15	27749799	missense	possibly damaging	0.66
R7075:Trio	UTSW	15	27898000	missense	unknown
R7094:Trio	UTSW	15	27891448	missense	unknown
R7123:Trio	UTSW	15	27742313	critical splice donor site	probably benign
R7130:Trio	UTSW	15	27742313	critical splice donor site	probably benign
R7214:Trio	UTSW	15	27871187	missense	probably damaging	0.97
R7292:Trio	UTSW	15	27828351	missense	possibly damaging	0.63
R7293:Trio	UTSW	15	27871289	missense	possibly damaging	0.66
R7352:Trio	UTSW	15	27732876	missense	probably damaging	0.96
R7426:Trio	UTSW	15	27856107	missense	probably benign	0.01
R7451:Trio	UTSW	15	27747913	missense	probably benign	0.07
R7558:Trio	UTSW	15	27831394	missense	possibly damaging	0.90
R7578:Trio	UTSW	15	27854939	missense	possibly damaging	0.94
R7596:Trio	UTSW	15	27749826	missense	probably damaging	0.99
R7604:Trio	UTSW	15	27736445	critical splice donor site	probably null
R7609:Trio	UTSW	15	27912642	missense	unknown
R7767:Trio	UTSW	15	27889418	missense	unknown
R7784:Trio	UTSW	15	27763994	missense	probably damaging	1.00
R7817:Trio	UTSW	15	27749866	missense	probably benign	0.35
R7833:Trio	UTSW	15	27774086	missense	probably damaging	0.99
R7873:Trio	UTSW	15	27805684	missense	possibly damaging	0.83
R7879:Trio	UTSW	15	27851924	missense	possibly damaging	0.94
R7989:Trio	UTSW	15	27772935	missense	probably damaging	0.97
R8022:Trio	UTSW	15	27749866	missense	probably benign	0.35
R8050:Trio	UTSW	15	27891454	missense	unknown
R8217:Trio	UTSW	15	27818969	missense	probably damaging	0.97
R8280:Trio	UTSW	15	27902910	missense	unknown
R8283:Trio	UTSW	15	27756542	missense	possibly damaging	0.79
R8300:Trio	UTSW	15	27855022	missense	possibly damaging	0.66
R8321:Trio	UTSW	15	27881326	missense	possibly damaging	0.90
R8477:Trio	UTSW	15	27773952	missense	possibly damaging	0.83
R8479:Trio	UTSW	15	27901200	missense	probably benign	0.25
X0024:Trio	UTSW	15	27765726	missense	possibly damaging	0.91
Z1176:Trio	UTSW	15	27771387	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AGAGTTCCCTGCTTCTGGTG -3'
(R):5'- AGTGTATGCTTGATCCCAGC -3'

Sequencing Primer
(F):5'- CTTCTGGTGGGTGCCTTCC -3'
(R):5'- GATCCCAGCCTCACTGTG -3'

Posted On

2015-09-24