Incidental Mutation 'R4573:Trio'
ID 342294
Institutional Source Beutler Lab
Gene Symbol Trio
Ensembl Gene ENSMUSG00000022263
Gene Name triple functional domain (PTPRF interacting)
Synonyms Solo, 6720464I07Rik
MMRRC Submission 041598-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4573 (G1)
Quality Score 217
Status Not validated
Chromosome 15
Chromosomal Location 27730651-28025848 bp(-) (GRCm38)
Type of Mutation small deletion (1 aa in frame mutation)
DNA Base Change (assembly) CCTTCTTCTTCT to CCTTCTTCT at 27772998 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000154653 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090247] [ENSMUST00000226287] [ENSMUST00000226644] [ENSMUST00000227337]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000090247
SMART Domains Protein: ENSMUSP00000087714
Gene: ENSMUSG00000022263

DomainStartEndE-ValueType
low complexity region 2 40 N/A INTRINSIC
SEC14 68 207 3.4e-26 SMART
SPEC 221 337 2.48e-9 SMART
SPEC 343 445 1.92e-15 SMART
SPEC 569 671 5.35e-14 SMART
SPEC 674 783 1.18e-6 SMART
SPEC 910 1011 2.6e-12 SMART
SPEC 1141 1243 7e-18 SMART
low complexity region 1249 1258 N/A INTRINSIC
RhoGEF 1296 1466 2.79e-53 SMART
PH 1480 1593 1.53e-9 SMART
SH3 1659 1720 1.9e-8 SMART
low complexity region 1788 1802 N/A INTRINSIC
low complexity region 1837 1863 N/A INTRINSIC
low complexity region 1936 1954 N/A INTRINSIC
RhoGEF 1973 2144 1.32e-63 SMART
PH 2158 2273 3.6e-6 SMART
low complexity region 2291 2341 N/A INTRINSIC
low complexity region 2371 2390 N/A INTRINSIC
low complexity region 2491 2503 N/A INTRINSIC
SH3 2558 2619 1.04e0 SMART
low complexity region 2640 2660 N/A INTRINSIC
IGc2 2701 2770 4e-12 SMART
S_TKc 2800 3054 4.84e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000226287
Predicted Effect probably benign
Transcript: ENSMUST00000226644
Predicted Effect probably benign
Transcript: ENSMUST00000227337
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large protein that functions as a GDP to GTP exchange factor. This protein promotes the reorganization of the actin cytoskeleton, thereby playing a role in cell migration and growth. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous mutant mice die during late embryonic development or shortly after birth. They exhibit abnormal skeletal myogenesis and display aberrant organization within the hippocampus and olfactory bulb. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam15 T C 3: 89,345,986 E212G probably damaging Het
Adam1b A C 5: 121,500,793 S730A probably benign Het
Akr1b10 T C 6: 34,392,129 V153A probably damaging Het
Ap1m2 T C 9: 21,305,758 Y94C probably damaging Het
Arhgef33 T C 17: 80,365,282 S320P probably damaging Het
Arsg T C 11: 109,517,282 S87P probably damaging Het
Asic3 A G 5: 24,417,192 Y458C probably damaging Het
Aspm G T 1: 139,479,507 W2044L probably damaging Het
Atad2b T C 12: 4,954,663 probably null Het
Atp1a2 T C 1: 172,278,637 I869M possibly damaging Het
Bpifb2 C T 2: 153,889,492 L263F probably damaging Het
C1s2 T C 6: 124,628,243 probably null Het
Carf G T 1: 60,148,112 A590S probably benign Het
Cbarp G T 10: 80,131,411 D658E probably damaging Het
Cd1d2 A G 3: 86,987,554 I78V probably benign Het
Cdc42bpb A T 12: 111,323,141 M418K probably benign Het
Cdhr3 A T 12: 33,068,153 probably null Het
Cep290 A G 10: 100,518,850 K932R probably benign Het
Ces1d A C 8: 93,181,534 N310K probably benign Het
Chka A G 19: 3,885,960 K240R probably damaging Het
Cltb C T 13: 54,598,761 R64H probably damaging Het
Cyp4f37 A G 17: 32,629,087 E193G probably benign Het
Dhrs9 C A 2: 69,397,641 H200N probably benign Het
Dnah6 T A 6: 73,086,181 N2698I probably damaging Het
Dnah8 T C 17: 30,700,406 S1118P probably benign Het
Dyrk1a A G 16: 94,692,023 Y705C possibly damaging Het
Elmod1 T C 9: 53,925,972 N183S probably damaging Het
Fam129a T C 1: 151,703,766 V412A possibly damaging Het
Fer1l6 G A 15: 58,626,280 probably null Het
Fsip2 A T 2: 82,986,166 Y4081F possibly damaging Het
Gm38394 A G 1: 133,659,389 I70T probably benign Het
Gsr A G 8: 33,693,853 D381G probably benign Het
Gucy1a1 A G 3: 82,108,922 L253S possibly damaging Het
Herc3 C A 6: 58,894,113 T69K possibly damaging Het
Hoxb13 A G 11: 96,194,951 Y170C probably damaging Het
Hsd3b5 T C 3: 98,619,648 M161V probably benign Het
Lrp6 G A 6: 134,470,730 R985* probably null Het
March5 T A 19: 37,220,394 I154K probably damaging Het
Mcemp1 A G 8: 3,665,835 probably null Het
Mrpl2 G T 17: 46,649,041 C212F possibly damaging Het
Mterf1a G A 5: 3,891,119 R250W possibly damaging Het
Mthfd1 A G 12: 76,294,138 probably null Het
Mul1 T C 4: 138,436,349 F19L probably benign Het
Mycbp2 G T 14: 103,346,297 A74E probably benign Het
Myo5a A T 9: 75,201,297 probably null Het
Ncor2 A T 5: 125,055,825 S33T probably damaging Het
Ninj1 A G 13: 49,194,987 N191S probably damaging Het
Nrap T C 19: 56,342,338 probably null Het
Ofcc1 G A 13: 40,015,388 T841I probably damaging Het
Olfr353 T C 2: 36,890,190 I219M probably damaging Het
Olfr50 T A 2: 36,793,479 M81K probably damaging Het
Osbpl5 C A 7: 143,694,316 V671L probably benign Het
Paics T C 5: 76,956,603 L25S probably benign Het
Pcmtd1 A G 1: 7,120,367 E20G probably damaging Het
Pgbd5 G A 8: 124,376,227 Q228* probably null Het
Pnpla7 T C 2: 25,050,873 V1079A probably damaging Het
Pou2f1 G A 1: 165,913,261 T113I probably benign Het
Ppp1r14c A G 10: 3,463,416 I150V possibly damaging Het
Ppp1r2 A G 16: 31,260,637 Y115H possibly damaging Het
Ptchd4 T C 17: 42,502,777 V523A probably benign Het
Rabep1 G C 11: 70,917,751 S468T probably damaging Het
Rgs6 T A 12: 83,066,015 W200R probably damaging Het
Ryr3 C T 2: 112,755,174 probably null Het
Scamp2 A T 9: 57,577,194 D20V probably damaging Het
Sec24d G A 3: 123,358,870 V844M probably damaging Het
Sept10 T A 10: 59,192,329 N57Y probably damaging Het
Sis T C 3: 72,928,237 K931E possibly damaging Het
Slamf7 T C 1: 171,636,366 T258A probably benign Het
Slc15a1 A G 14: 121,487,029 S144P probably damaging Het
Slc6a7 A T 18: 61,002,181 V425E probably benign Het
Syt7 C T 19: 10,439,212 R253* probably null Het
Tm4sf1 A T 3: 57,294,785 C2S possibly damaging Het
Trpm3 C T 19: 22,902,142 H594Y probably damaging Het
Tshz1 A T 18: 84,015,082 N400K probably damaging Het
Vat1 A T 11: 101,460,615 M300K probably benign Het
Vmn1r70 C A 7: 10,633,629 probably null Het
Vmn2r5 C T 3: 64,503,918 D410N probably damaging Het
Yap1 T C 9: 7,934,681 D428G probably damaging Het
Zfp157 A G 5: 138,456,929 Y463C probably damaging Het
Other mutations in Trio
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00480:Trio APN 15 27912743 splice site probably benign
IGL01011:Trio APN 15 27736489 missense probably damaging 0.96
IGL01090:Trio APN 15 27773007 missense probably damaging 1.00
IGL01145:Trio APN 15 27818167 splice site probably benign
IGL01147:Trio APN 15 27881320 missense probably damaging 1.00
IGL01161:Trio APN 15 27749781 missense probably damaging 1.00
IGL01324:Trio APN 15 27905323 missense probably benign 0.42
IGL01352:Trio APN 15 27901229 missense probably benign 0.01
IGL01366:Trio APN 15 27732868 missense possibly damaging 0.76
IGL01443:Trio APN 15 27838775 splice site probably benign
IGL01454:Trio APN 15 27832985 missense probably benign 0.32
IGL01695:Trio APN 15 27773001 missense probably damaging 1.00
IGL01765:Trio APN 15 27764026 missense possibly damaging 0.85
IGL01860:Trio APN 15 27846810 missense probably damaging 1.00
IGL01879:Trio APN 15 27741033 missense probably benign 0.12
IGL01991:Trio APN 15 27871274 missense possibly damaging 0.95
IGL02106:Trio APN 15 27744158 missense possibly damaging 0.85
IGL02209:Trio APN 15 27744053 missense probably damaging 1.00
IGL02232:Trio APN 15 27902561 missense probably benign 0.24
IGL02304:Trio APN 15 27735436 missense probably damaging 0.96
IGL02504:Trio APN 15 27847390 nonsense probably null
IGL02508:Trio APN 15 27818104 missense possibly damaging 0.65
IGL02541:Trio APN 15 27844930 splice site probably benign
IGL02617:Trio APN 15 27841849 splice site probably benign
IGL02675:Trio APN 15 27768039 unclassified probably benign
IGL02817:Trio APN 15 27902881 missense probably benign 0.01
IGL02993:Trio APN 15 27830239 splice site probably benign
IGL03007:Trio APN 15 27902742 missense probably damaging 0.99
IGL03135:Trio APN 15 27832011 splice site probably benign
IGL03225:Trio APN 15 27902695 missense probably benign 0.30
R0063:Trio UTSW 15 27881437 splice site probably benign
R0063:Trio UTSW 15 27881437 splice site probably benign
R0302:Trio UTSW 15 27902517 missense probably damaging 1.00
R0505:Trio UTSW 15 27767907 missense probably benign 0.00
R0506:Trio UTSW 15 27854963 missense probably benign 0.12
R0564:Trio UTSW 15 27805822 missense probably damaging 1.00
R0659:Trio UTSW 15 27831399 missense probably damaging 0.97
R0882:Trio UTSW 15 27732894 missense probably damaging 1.00
R0939:Trio UTSW 15 27741250 critical splice donor site probably null
R1018:Trio UTSW 15 27871171 missense probably damaging 1.00
R1439:Trio UTSW 15 27897914 missense probably damaging 1.00
R1456:Trio UTSW 15 27753804 splice site probably benign
R1488:Trio UTSW 15 27740967 missense probably damaging 1.00
R1522:Trio UTSW 15 27732640 missense probably benign 0.28
R1531:Trio UTSW 15 27832985 missense probably benign 0.32
R1640:Trio UTSW 15 27833044 missense probably damaging 1.00
R1646:Trio UTSW 15 27758347 missense possibly damaging 0.91
R1682:Trio UTSW 15 27744146 splice site probably null
R1780:Trio UTSW 15 27744038 missense possibly damaging 0.93
R1791:Trio UTSW 15 27841756 missense probably damaging 1.00
R1803:Trio UTSW 15 27748340 missense probably benign
R1817:Trio UTSW 15 27742495 nonsense probably null
R1853:Trio UTSW 15 27756536 missense probably damaging 1.00
R1898:Trio UTSW 15 27742380 missense possibly damaging 0.52
R1937:Trio UTSW 15 27833056 missense probably damaging 1.00
R1938:Trio UTSW 15 27732891 missense probably damaging 0.98
R2025:Trio UTSW 15 27744137 missense probably damaging 0.99
R2025:Trio UTSW 15 27773927 missense probably damaging 1.00
R2050:Trio UTSW 15 27851945 missense possibly damaging 0.85
R2186:Trio UTSW 15 27823975 splice site probably null
R2913:Trio UTSW 15 27854912 missense probably damaging 1.00
R3151:Trio UTSW 15 27805776 missense probably damaging 1.00
R3771:Trio UTSW 15 27748091 missense probably damaging 0.98
R3773:Trio UTSW 15 27748091 missense probably damaging 0.98
R3826:Trio UTSW 15 27833070 missense probably damaging 1.00
R4015:Trio UTSW 15 27744101 missense possibly damaging 0.71
R4359:Trio UTSW 15 27749797 nonsense probably null
R4370:Trio UTSW 15 27748337 nonsense probably null
R4547:Trio UTSW 15 27818982 missense possibly damaging 0.89
R4620:Trio UTSW 15 27871171 missense probably damaging 1.00
R4735:Trio UTSW 15 27752789 splice site probably null
R4764:Trio UTSW 15 27732538 nonsense probably null
R4775:Trio UTSW 15 27881342 nonsense probably null
R4942:Trio UTSW 15 27752725 missense probably benign 0.21
R5004:Trio UTSW 15 27755178 missense probably damaging 1.00
R5149:Trio UTSW 15 27754029 missense possibly damaging 0.74
R5183:Trio UTSW 15 27902600 missense probably benign 0.00
R5186:Trio UTSW 15 27897991 missense probably damaging 0.97
R5268:Trio UTSW 15 27748286 missense probably benign 0.02
R5344:Trio UTSW 15 27735532 missense probably benign 0.12
R5407:Trio UTSW 15 27844806 splice site probably null
R5442:Trio UTSW 15 27856194 missense probably benign 0.04
R5617:Trio UTSW 15 27902748 missense probably benign
R5778:Trio UTSW 15 27856164 missense probably benign 0.33
R5986:Trio UTSW 15 27851933 missense possibly damaging 0.88
R5990:Trio UTSW 15 27891459 missense probably benign 0.10
R6011:Trio UTSW 15 27735545 missense probably damaging 0.98
R6063:Trio UTSW 15 27891379 missense possibly damaging 0.94
R6166:Trio UTSW 15 27818071 missense probably damaging 0.96
R6187:Trio UTSW 15 27743952 critical splice donor site probably null
R6387:Trio UTSW 15 27752739 missense probably damaging 1.00
R6402:Trio UTSW 15 27902911 missense probably benign 0.02
R6478:Trio UTSW 15 27856107 missense probably benign 0.01
R6528:Trio UTSW 15 27805870 missense probably damaging 1.00
R6662:Trio UTSW 15 27854996 missense probably benign 0.00
R6825:Trio UTSW 15 27889308 missense probably damaging 0.98
R6890:Trio UTSW 15 27919288 unclassified probably benign
R6945:Trio UTSW 15 27824090 missense probably damaging 1.00
R7027:Trio UTSW 15 27805654 missense possibly damaging 0.86
R7046:Trio UTSW 15 27832051 missense probably damaging 1.00
R7049:Trio UTSW 15 27749799 missense possibly damaging 0.66
R7075:Trio UTSW 15 27898000 missense unknown
R7094:Trio UTSW 15 27891448 missense unknown
R7123:Trio UTSW 15 27742313 critical splice donor site probably benign
R7130:Trio UTSW 15 27742313 critical splice donor site probably benign
R7214:Trio UTSW 15 27871187 missense probably damaging 0.97
R7292:Trio UTSW 15 27828351 missense possibly damaging 0.63
R7293:Trio UTSW 15 27871289 missense possibly damaging 0.66
R7352:Trio UTSW 15 27732876 missense probably damaging 0.96
R7426:Trio UTSW 15 27856107 missense probably benign 0.01
R7451:Trio UTSW 15 27747913 missense probably benign 0.07
R7558:Trio UTSW 15 27831394 missense possibly damaging 0.90
R7578:Trio UTSW 15 27854939 missense possibly damaging 0.94
R7596:Trio UTSW 15 27749826 missense probably damaging 0.99
R7604:Trio UTSW 15 27736445 critical splice donor site probably null
R7609:Trio UTSW 15 27912642 missense unknown
R7767:Trio UTSW 15 27889418 missense unknown
R7784:Trio UTSW 15 27763994 missense probably damaging 1.00
R7817:Trio UTSW 15 27749866 missense probably benign 0.35
R7833:Trio UTSW 15 27774086 missense probably damaging 0.99
R7873:Trio UTSW 15 27805684 missense possibly damaging 0.83
R7879:Trio UTSW 15 27851924 missense possibly damaging 0.94
R7989:Trio UTSW 15 27772935 missense probably damaging 0.97
R8022:Trio UTSW 15 27749866 missense probably benign 0.35
R8050:Trio UTSW 15 27891454 missense unknown
R8217:Trio UTSW 15 27818969 missense probably damaging 0.97
R8280:Trio UTSW 15 27902910 missense unknown
R8283:Trio UTSW 15 27756542 missense possibly damaging 0.79
R8300:Trio UTSW 15 27855022 missense possibly damaging 0.66
R8321:Trio UTSW 15 27881326 missense possibly damaging 0.90
R8477:Trio UTSW 15 27773952 missense possibly damaging 0.83
R8479:Trio UTSW 15 27901200 missense probably benign 0.25
R8682:Trio UTSW 15 27905192 missense unknown
R8688:Trio UTSW 15 27748238 missense possibly damaging 0.61
R8708:Trio UTSW 15 27732546 missense probably damaging 0.99
R8709:Trio UTSW 15 27919237 missense unknown
R8713:Trio UTSW 15 27743951 critical splice donor site probably benign
R8798:Trio UTSW 15 27851837 missense possibly damaging 0.92
R8812:Trio UTSW 15 27905225 missense unknown
R8816:Trio UTSW 15 27741271 missense probably damaging 0.96
R8828:Trio UTSW 15 27741064 missense possibly damaging 0.93
R8987:Trio UTSW 15 27732687 missense probably benign 0.23
R9051:Trio UTSW 15 27732684 missense possibly damaging 0.78
R9069:Trio UTSW 15 27852011 missense possibly damaging 0.83
R9075:Trio UTSW 15 27773936 nonsense probably null
R9079:Trio UTSW 15 27732937 missense possibly damaging 0.52
R9139:Trio UTSW 15 27749836 nonsense probably null
X0024:Trio UTSW 15 27765726 missense possibly damaging 0.91
Z1176:Trio UTSW 15 27771387 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGAGTTCCCTGCTTCTGGTG -3'
(R):5'- AGTGTATGCTTGATCCCAGC -3'

Sequencing Primer
(F):5'- CTTCTGGTGGGTGCCTTCC -3'
(R):5'- GATCCCAGCCTCACTGTG -3'
Posted On 2015-09-24