Mutagenetix > Incidental Mutation

Incidental Mutation 'R0316:Greb1l'

34230

Institutional Source

Beutler Lab

Gene Symbol

Greb1l

Ensembl Gene

ENSMUSG00000042942

Gene Name

growth regulation by estrogen in breast cancer-like

Synonyms

AK220484, mKIAA4095

MMRRC Submission

038526-MU

Accession Numbers

Genbank: NM_001083628; MGI: 3576497

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0316 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

10325177-10562934 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 10547420 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 1546 (Y1546C)

Ref Sequence

ENSEMBL: ENSMUSP00000049003 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048977] [ENSMUST00000172680]

AlphaFold

B9EJV3

Predicted Effect

probably damaging
Transcript: ENSMUST00000048977
AA Change: Y1546C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000049003
Gene: ENSMUSG00000042942
AA Change: Y1546C

Domain	Start	End	E-Value	Type
Pfam:GREB1	1	1172	N/A	PFAM
Pfam:GREB1	1154	1913	N/A	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000122744

Predicted Effect

probably benign
Transcript: ENSMUST00000172680

SMART Domains

Protein: ENSMUSP00000134314
Gene: ENSMUSG00000042942

Domain	Start	End	E-Value	Type
low complexity region	116	129	N/A	INTRINSIC

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.5%
20x: 96.2%

Validation Efficiency

Allele List at MGI

All alleles(5) : Targeted, other(2) Gene trapped(3)

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130401M01Rik	A	T	15: 58,025,369	F276I	probably damaging	Het
Ado	A	G	10: 67,548,718	L19P	possibly damaging	Het
Ago2	T	C	15: 73,130,876	H169R	probably damaging	Het
Asic1	G	A	15: 99,671,938	A47T	probably benign	Het
Atg16l2	A	T	7: 101,293,396	I364N	probably damaging	Het
C130050O18Rik	G	A	5: 139,414,558	R122Q	probably damaging	Het
Capn7	T	A	14: 31,347,809	C197S	probably benign	Het
Casp16-ps	T	C	17: 23,552,092	D113G	probably damaging	Het
Cdh18	T	A	15: 23,366,913	V235D	probably damaging	Het
Clca4a	G	T	3: 144,953,764	T777K	probably damaging	Het
Col17a1	A	G	19: 47,685,533		probably null	Het
Col5a3	C	A	9: 20,775,325	D1335Y	unknown	Het
Cpxm1	T	C	2: 130,393,171	E576G	probably damaging	Het
Dcbld2	T	C	16: 58,433,445	S182P	probably damaging	Het
Dclk1	C	T	3: 55,502,892	S616L	probably damaging	Het
Dgcr14	G	A	16: 17,910,094	P103S	probably benign	Het
Dll4	C	A	2: 119,331,153	D405E	probably damaging	Het
Dnah1	G	A	14: 31,278,151	R2462C	probably benign	Het
Dnah3	A	T	7: 119,965,659	Y2594N	possibly damaging	Het
Fam110a	C	A	2: 151,970,086	A255S	probably benign	Het
Fbn2	G	A	18: 58,113,325	R502W	probably damaging	Het
Fgl2	A	G	5: 21,375,523	S288G	possibly damaging	Het
Gm1527	T	C	3: 28,915,774	S342P	probably damaging	Het
Gm19668	A	T	10: 77,798,730		probably benign	Het
Gm5901	A	T	7: 105,377,315	T97S	probably damaging	Het
Impg1	A	T	9: 80,342,065	S619T	probably damaging	Het
Itih2	C	A	2: 10,105,246	Q565H	possibly damaging	Het
Kbtbd6	T	A	14: 79,453,024	N386K	probably benign	Het
Lama3	T	C	18: 12,519,877	M218T	probably benign	Het
Lipg	T	C	18: 74,960,941	S12G	probably benign	Het
Marf1	C	T	16: 14,142,534	A549T	probably damaging	Het
Mex3d	G	T	10: 80,381,671	P571T	probably damaging	Het
Neb	A	C	2: 52,195,470	Y1538D	possibly damaging	Het
Nsd1	T	C	13: 55,213,771	I184T	probably damaging	Het
Olfr1143	T	C	2: 87,803,181	F264S	probably damaging	Het
Olfr1451	T	A	19: 12,999,402	C139S	probably damaging	Het
Olfr372	C	T	8: 72,058,400	T240M	probably damaging	Het
Pacs1	T	C	19: 5,135,121		silent	Het
Pdcd11	T	C	19: 47,113,172	V932A	probably damaging	Het
Pkd2	A	G	5: 104,477,166	D276G	probably damaging	Het
Pkia	T	A	3: 7,437,439	D25E	probably damaging	Het
Plxna2	A	C	1: 194,644,150	S131R	probably damaging	Het
Prelid1	T	C	13: 55,324,407	V132A	possibly damaging	Het
Psma3	T	C	12: 70,983,389	Y59H	probably benign	Het
Ptchd3	A	C	11: 121,842,090	E602A	possibly damaging	Het
Ptpro	T	C	6: 137,376,989	V121A	possibly damaging	Het
Ptprt	A	G	2: 161,607,319	L878P	probably damaging	Het
Pxn	G	A	5: 115,553,968	G370S	probably damaging	Het
Rcn2	G	T	9: 56,042,169	A40S	probably benign	Het
Rnf215	A	G	11: 4,139,760	N258D	probably damaging	Het
Rnpc3	T	C	3: 113,629,973	T28A	probably damaging	Het
Rtel1	T	A	2: 181,356,002	V1100E	possibly damaging	Het
Scn3a	T	A	2: 65,460,829	I1858F	probably damaging	Het
Slc9c1	G	A	16: 45,580,232	R735Q	possibly damaging	Het
Snapc1	C	T	12: 73,975,032	R81C	probably damaging	Het
Spata13	A	G	14: 60,692,339	T449A	probably benign	Het
Svep1	A	G	4: 58,072,737	W2191R	probably damaging	Het
Thbs1	G	A	2: 118,117,574	R405H	probably damaging	Het
Tnn	A	G	1: 160,120,567	Y859H	possibly damaging	Het
Tonsl	A	G	15: 76,629,300	S1245P	possibly damaging	Het
Tpcn1	G	A	5: 120,539,259	T661M	probably damaging	Het
Trap1	A	G	16: 4,045,560	F533L	probably benign	Het
Ttc23	T	C	7: 67,679,073		probably null	Het
Vax2	T	C	6: 83,711,444	S50P	possibly damaging	Het
Vmn1r5	A	C	6: 56,985,799	E153A	probably benign	Het
Vmn2r14	G	T	5: 109,218,896	P486Q	probably benign	Het
Vmn2r96	T	A	17: 18,582,565	F246I	probably damaging	Het
Zc3h10	C	A	10: 128,544,755	E244D	probably damaging	Het
Zdhhc18	T	A	4: 133,613,655	K265*	probably null	Het

Other mutations in Greb1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00485:Greb1l	APN	18	10555962	missense	possibly damaging	0.90
IGL01554:Greb1l	APN	18	10522144	missense	probably benign	0.01
IGL01563:Greb1l	APN	18	10469399	missense	probably damaging	0.99
IGL01944:Greb1l	APN	18	10557280	missense	possibly damaging	0.91
IGL02110:Greb1l	APN	18	10515271	missense	probably damaging	1.00
IGL02249:Greb1l	APN	18	10532961	missense	probably damaging	1.00
IGL02318:Greb1l	APN	18	10469388	missense	possibly damaging	0.91
IGL02340:Greb1l	APN	18	10515200	missense	probably damaging	0.99
IGL02516:Greb1l	APN	18	10537064	missense	probably benign	0.31
IGL02566:Greb1l	APN	18	10503299	missense	probably damaging	0.99
IGL02583:Greb1l	APN	18	10542362	missense	probably damaging	1.00
IGL02838:Greb1l	APN	18	10560430	missense	probably damaging	1.00
A4554:Greb1l	UTSW	18	10532862	missense	possibly damaging	0.58
PIT4453001:Greb1l	UTSW	18	10533031	missense	probably damaging	0.98
PIT4453001:Greb1l	UTSW	18	10533032	missense	probably benign	0.08
R0099:Greb1l	UTSW	18	10509158	missense	probably damaging	1.00
R0226:Greb1l	UTSW	18	10522076	intron	probably benign
R0234:Greb1l	UTSW	18	10560331	missense	probably damaging	1.00
R0234:Greb1l	UTSW	18	10560331	missense	probably damaging	1.00
R0239:Greb1l	UTSW	18	10458567	splice site	probably benign
R0369:Greb1l	UTSW	18	10469375	missense	possibly damaging	0.80
R0394:Greb1l	UTSW	18	10523374	missense	probably damaging	0.99
R0478:Greb1l	UTSW	18	10509281	missense	probably damaging	1.00
R0555:Greb1l	UTSW	18	10458781	splice site	probably benign
R0671:Greb1l	UTSW	18	10474303	missense	probably damaging	1.00
R1282:Greb1l	UTSW	18	10547289	missense	probably benign	0.13
R1574:Greb1l	UTSW	18	10554997	missense	possibly damaging	0.95
R1574:Greb1l	UTSW	18	10554997	missense	possibly damaging	0.95
R1607:Greb1l	UTSW	18	10529703	missense	possibly damaging	0.85
R1666:Greb1l	UTSW	18	10501080	critical splice donor site	probably null
R1666:Greb1l	UTSW	18	10529708	critical splice donor site	probably null
R1720:Greb1l	UTSW	18	10553848	missense	probably benign	0.19
R1808:Greb1l	UTSW	18	10542143	missense	probably benign
R1829:Greb1l	UTSW	18	10509314	missense	probably damaging	1.00
R1897:Greb1l	UTSW	18	10498992	missense	probably benign	0.00
R1967:Greb1l	UTSW	18	10501049	missense	possibly damaging	0.91
R2025:Greb1l	UTSW	18	10515221	missense	possibly damaging	0.71
R2086:Greb1l	UTSW	18	10523281	missense	probably damaging	1.00
R2125:Greb1l	UTSW	18	10511422	missense	probably damaging	0.98
R2139:Greb1l	UTSW	18	10555011	missense	probably damaging	1.00
R2255:Greb1l	UTSW	18	10554857	missense	probably damaging	1.00
R2256:Greb1l	UTSW	18	10503307	missense	possibly damaging	0.91
R2257:Greb1l	UTSW	18	10503307	missense	possibly damaging	0.91
R2880:Greb1l	UTSW	18	10547288	missense	possibly damaging	0.93
R3623:Greb1l	UTSW	18	10542380	missense	probably damaging	0.99
R3778:Greb1l	UTSW	18	10469444	missense	possibly damaging	0.60
R3975:Greb1l	UTSW	18	10522247	missense	possibly damaging	0.71
R4038:Greb1l	UTSW	18	10515209	missense	possibly damaging	0.93
R4062:Greb1l	UTSW	18	10522150	missense	probably damaging	0.99
R4134:Greb1l	UTSW	18	10529708	critical splice donor site	probably null
R4342:Greb1l	UTSW	18	10544561	missense	probably benign	0.12
R4409:Greb1l	UTSW	18	10503182	missense	possibly damaging	0.70
R4600:Greb1l	UTSW	18	10553705	missense	probably damaging	1.00
R4618:Greb1l	UTSW	18	10498965	missense	probably benign	0.00
R4683:Greb1l	UTSW	18	10529563	splice site	probably null
R4686:Greb1l	UTSW	18	10522112	missense	probably damaging	0.98
R4707:Greb1l	UTSW	18	10532922	missense	probably benign	0.02
R4780:Greb1l	UTSW	18	10541792	missense	probably benign	0.00
R4819:Greb1l	UTSW	18	10458358	missense	probably damaging	1.00
R4925:Greb1l	UTSW	18	10547447	missense	possibly damaging	0.79
R4960:Greb1l	UTSW	18	10547306	missense	probably damaging	0.99
R5150:Greb1l	UTSW	18	10555950	frame shift	probably null
R5154:Greb1l	UTSW	18	10458312	missense	probably benign	0.02
R5269:Greb1l	UTSW	18	10511409	missense	probably benign
R5290:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5310:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5328:Greb1l	UTSW	18	10553720	missense	probably damaging	1.00
R5337:Greb1l	UTSW	18	10509143	missense	probably damaging	1.00
R5393:Greb1l	UTSW	18	10458312	missense	probably benign	0.02
R5402:Greb1l	UTSW	18	10537169	missense	probably benign	0.26
R5718:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5719:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5720:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5721:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5902:Greb1l	UTSW	18	10538302	missense	probably benign	0.00
R5993:Greb1l	UTSW	18	10544455	missense	probably benign	0.10
R6035:Greb1l	UTSW	18	10501025	missense	possibly damaging	0.91
R6035:Greb1l	UTSW	18	10501025	missense	possibly damaging	0.91
R6045:Greb1l	UTSW	18	10547068	missense	probably damaging	1.00
R6063:Greb1l	UTSW	18	10557340	missense	probably damaging	1.00
R6297:Greb1l	UTSW	18	10469494	missense	probably damaging	1.00
R6405:Greb1l	UTSW	18	10501076	missense	probably benign	0.30
R6552:Greb1l	UTSW	18	10541814	missense	probably benign	0.00
R6572:Greb1l	UTSW	18	10522131	missense	probably benign	0.07
R6575:Greb1l	UTSW	18	10547347	missense	possibly damaging	0.88
R6922:Greb1l	UTSW	18	10547482	missense	possibly damaging	0.88
R6957:Greb1l	UTSW	18	10558786	missense	probably benign	0.23
R6962:Greb1l	UTSW	18	10547327	missense	probably damaging	1.00
R7012:Greb1l	UTSW	18	10529707	critical splice donor site	probably null
R7179:Greb1l	UTSW	18	10544576	missense	probably benign	0.00
R7251:Greb1l	UTSW	18	10515319	missense	probably damaging	1.00
R7275:Greb1l	UTSW	18	10544561	missense	probably benign	0.12
R7301:Greb1l	UTSW	18	10544970	missense	probably damaging	1.00
R7307:Greb1l	UTSW	18	10538142	missense	probably damaging	0.99
R7455:Greb1l	UTSW	18	10554915	missense	probably damaging	1.00
R7832:Greb1l	UTSW	18	10542056	missense	probably benign	0.38
R7934:Greb1l	UTSW	18	10474371	nonsense	probably null
R8137:Greb1l	UTSW	18	10474357	missense	possibly damaging	0.77
R8138:Greb1l	UTSW	18	10533060	missense	probably benign	0.13
R8208:Greb1l	UTSW	18	10510703	missense	probably damaging	1.00
R8227:Greb1l	UTSW	18	10515371	missense	probably damaging	1.00
R8312:Greb1l	UTSW	18	10511587	intron	probably benign
R8331:Greb1l	UTSW	18	10458706	missense	possibly damaging	0.96
R8364:Greb1l	UTSW	18	10529687	missense	possibly damaging	0.85
R8389:Greb1l	UTSW	18	10529613	missense	probably benign	0.00
R8695:Greb1l	UTSW	18	10544450	missense	probably benign	0.01
R8795:Greb1l	UTSW	18	10553739	missense	probably damaging	0.98
R8836:Greb1l	UTSW	18	10509257	missense	probably benign	0.30
R8862:Greb1l	UTSW	18	10555042	missense	possibly damaging	0.90
R8872:Greb1l	UTSW	18	10529684	missense	probably benign	0.18
R8874:Greb1l	UTSW	18	10544896	missense	probably benign	0.01
R8886:Greb1l	UTSW	18	10553843	missense	probably benign	0.21
R8921:Greb1l	UTSW	18	10541825	missense	probably benign	0.01
R8997:Greb1l	UTSW	18	10510747	missense	probably damaging	1.00
R9015:Greb1l	UTSW	18	10541675	missense	probably benign	0.00
R9018:Greb1l	UTSW	18	10542004	missense	possibly damaging	0.76
R9074:Greb1l	UTSW	18	10532797	missense	probably damaging	1.00
R9074:Greb1l	UTSW	18	10558795	missense	probably damaging	1.00
R9117:Greb1l	UTSW	18	10542422	missense	probably benign	0.31
R9189:Greb1l	UTSW	18	10499983	missense	probably benign
R9332:Greb1l	UTSW	18	10532796	missense	possibly damaging	0.92
R9367:Greb1l	UTSW	18	10522130	missense	probably benign	0.00
R9497:Greb1l	UTSW	18	10458600	missense	probably benign	0.00
R9796:Greb1l	UTSW	18	10538233	missense	possibly damaging	0.69
Z1176:Greb1l	UTSW	18	10515305	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTCAGCAAGCAGGGCAGACATC -3'
(R):5'- GCAGGGCAATTCTCAAAGGCAACC -3'

Sequencing Primer
(F):5'- CCCCTGGTTTCTGACAAGGTAG -3'
(R):5'- TTCTCAAAGGCAACCTCTGG -3'

Posted On

2013-05-09