Incidental Mutation 'R4573:Chka'
ID 342306
Institutional Source Beutler Lab
Gene Symbol Chka
Ensembl Gene ENSMUSG00000024843
Gene Name choline kinase alpha
Synonyms Chk, ChoK, EtnK-alpha, choline/ethanolamine kinase alpha, CK/EK-alpha
MMRRC Submission 041598-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4573 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 3901773-3944369 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 3935960 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 240 (K240R)
Ref Sequence ENSEMBL: ENSMUSP00000025760 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025760] [ENSMUST00000072055] [ENSMUST00000128694] [ENSMUST00000153343]
AlphaFold O54804
Predicted Effect probably damaging
Transcript: ENSMUST00000025760
AA Change: K240R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025760
Gene: ENSMUSG00000024843
AA Change: K240R

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
low complexity region 53 74 N/A INTRINSIC
Pfam:APH 108 373 2.4e-11 PFAM
Pfam:Choline_kinase 135 370 8.2e-82 PFAM
Pfam:EcKinase 211 345 2.5e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000072055
AA Change: K222R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000071933
Gene: ENSMUSG00000024843
AA Change: K222R

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
low complexity region 53 74 N/A INTRINSIC
Pfam:APH 108 358 6.4e-12 PFAM
Pfam:Choline_kinase 135 352 1.6e-84 PFAM
Pfam:EcKinase 190 329 2e-7 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000125640
AA Change: K163R
SMART Domains Protein: ENSMUSP00000119493
Gene: ENSMUSG00000024843
AA Change: K163R

DomainStartEndE-ValueType
Pfam:Choline_kinase 40 230 2.2e-49 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125859
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127544
Predicted Effect probably benign
Transcript: ENSMUST00000128694
SMART Domains Protein: ENSMUSP00000119919
Gene: ENSMUSG00000024843

DomainStartEndE-ValueType
PDB:4DA5|B 1 150 2e-60 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146463
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148325
Predicted Effect probably benign
Transcript: ENSMUST00000153343
Predicted Effect probably benign
Transcript: ENSMUST00000139655
SMART Domains Protein: ENSMUSP00000116427
Gene: ENSMUSG00000024843

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
PDB:4DA5|B 17 160 3e-68 PDB
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The major pathway for the biosynthesis of phosphatidylcholine occurs via the CDP-choline pathway. The protein encoded by this gene is the initial enzyme in the sequence and may play a regulatory role. The encoded protein also catalyzes the phosphorylation of ethanolamine. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality between E3.5 and E7.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam15 T C 3: 89,253,293 (GRCm39) E212G probably damaging Het
Adam1b A C 5: 121,638,856 (GRCm39) S730A probably benign Het
Akr1b10 T C 6: 34,369,064 (GRCm39) V153A probably damaging Het
Ap1m2 T C 9: 21,217,054 (GRCm39) Y94C probably damaging Het
Arhgef33 T C 17: 80,672,711 (GRCm39) S320P probably damaging Het
Arsg T C 11: 109,408,108 (GRCm39) S87P probably damaging Het
Asic3 A G 5: 24,622,190 (GRCm39) Y458C probably damaging Het
Aspm G T 1: 139,407,245 (GRCm39) W2044L probably damaging Het
Atad2b T C 12: 5,004,663 (GRCm39) probably null Het
Atp1a2 T C 1: 172,106,204 (GRCm39) I869M possibly damaging Het
Bpifb2 C T 2: 153,731,412 (GRCm39) L263F probably damaging Het
C1s2 T C 6: 124,605,202 (GRCm39) probably null Het
Carf G T 1: 60,187,271 (GRCm39) A590S probably benign Het
Cbarp G T 10: 79,967,245 (GRCm39) D658E probably damaging Het
Cd1d2 A G 3: 86,894,861 (GRCm39) I78V probably benign Het
Cdc42bpb A T 12: 111,289,575 (GRCm39) M418K probably benign Het
Cdhr3 A T 12: 33,118,152 (GRCm39) probably null Het
Cep290 A G 10: 100,354,712 (GRCm39) K932R probably benign Het
Ces1d A C 8: 93,908,162 (GRCm39) N310K probably benign Het
Cltb C T 13: 54,746,574 (GRCm39) R64H probably damaging Het
Cyp4f37 A G 17: 32,848,061 (GRCm39) E193G probably benign Het
Dhrs9 C A 2: 69,227,985 (GRCm39) H200N probably benign Het
Dnah6 T A 6: 73,063,164 (GRCm39) N2698I probably damaging Het
Dnah8 T C 17: 30,919,380 (GRCm39) S1118P probably benign Het
Dyrk1a A G 16: 94,492,882 (GRCm39) Y705C possibly damaging Het
Elmod1 T C 9: 53,833,256 (GRCm39) N183S probably damaging Het
Fer1l6 G A 15: 58,498,129 (GRCm39) probably null Het
Fsip2 A T 2: 82,816,510 (GRCm39) Y4081F possibly damaging Het
Gsr A G 8: 34,183,881 (GRCm39) D381G probably benign Het
Gucy1a1 A G 3: 82,016,229 (GRCm39) L253S possibly damaging Het
Herc3 C A 6: 58,871,098 (GRCm39) T69K possibly damaging Het
Hoxb13 A G 11: 96,085,777 (GRCm39) Y170C probably damaging Het
Hsd3b5 T C 3: 98,526,964 (GRCm39) M161V probably benign Het
Lrp6 G A 6: 134,447,693 (GRCm39) R985* probably null Het
Marchf5 T A 19: 37,197,793 (GRCm39) I154K probably damaging Het
Mcemp1 A G 8: 3,715,835 (GRCm39) probably null Het
Mrpl2 G T 17: 46,959,967 (GRCm39) C212F possibly damaging Het
Mterf1a G A 5: 3,941,119 (GRCm39) R250W possibly damaging Het
Mthfd1 A G 12: 76,340,912 (GRCm39) probably null Het
Mul1 T C 4: 138,163,660 (GRCm39) F19L probably benign Het
Mycbp2 G T 14: 103,583,733 (GRCm39) A74E probably benign Het
Myo5a A T 9: 75,108,579 (GRCm39) probably null Het
Ncor2 A T 5: 125,132,889 (GRCm39) S33T probably damaging Het
Niban1 T C 1: 151,579,517 (GRCm39) V412A possibly damaging Het
Ninj1 A G 13: 49,348,463 (GRCm39) N191S probably damaging Het
Nrap T C 19: 56,330,770 (GRCm39) probably null Het
Ofcc1 G A 13: 40,168,864 (GRCm39) T841I probably damaging Het
Or1j21 T A 2: 36,683,491 (GRCm39) M81K probably damaging Het
Or1n1b T C 2: 36,780,202 (GRCm39) I219M probably damaging Het
Osbpl5 C A 7: 143,248,053 (GRCm39) V671L probably benign Het
Paics T C 5: 77,104,450 (GRCm39) L25S probably benign Het
Pcmtd1 A G 1: 7,190,591 (GRCm39) E20G probably damaging Het
Pgbd5 G A 8: 125,102,966 (GRCm39) Q228* probably null Het
Pnpla7 T C 2: 24,940,885 (GRCm39) V1079A probably damaging Het
Pou2f1 G A 1: 165,740,830 (GRCm39) T113I probably benign Het
Ppp1r14c A G 10: 3,413,416 (GRCm39) I150V possibly damaging Het
Ppp1r2 A G 16: 31,079,455 (GRCm39) Y115H possibly damaging Het
Ptchd4 T C 17: 42,813,668 (GRCm39) V523A probably benign Het
Rabep1 G C 11: 70,808,577 (GRCm39) S468T probably damaging Het
Rgs6 T A 12: 83,112,789 (GRCm39) W200R probably damaging Het
Ryr3 C T 2: 112,585,519 (GRCm39) probably null Het
Scamp2 A T 9: 57,484,477 (GRCm39) D20V probably damaging Het
Sec24d G A 3: 123,152,519 (GRCm39) V844M probably damaging Het
Septin10 T A 10: 59,028,151 (GRCm39) N57Y probably damaging Het
Sis T C 3: 72,835,570 (GRCm39) K931E possibly damaging Het
Slamf7 T C 1: 171,463,934 (GRCm39) T258A probably benign Het
Slc15a1 A G 14: 121,724,441 (GRCm39) S144P probably damaging Het
Slc6a7 A T 18: 61,135,253 (GRCm39) V425E probably benign Het
Syt7 C T 19: 10,416,576 (GRCm39) R253* probably null Het
Tm4sf1 A T 3: 57,202,206 (GRCm39) C2S possibly damaging Het
Trio CCTTCTTCTTCT CCTTCTTCT 15: 27,773,084 (GRCm39) probably benign Het
Trpm3 C T 19: 22,879,506 (GRCm39) H594Y probably damaging Het
Tshz1 A T 18: 84,033,207 (GRCm39) N400K probably damaging Het
Vat1 A T 11: 101,351,441 (GRCm39) M300K probably benign Het
Vmn1r70 C A 7: 10,367,556 (GRCm39) probably null Het
Vmn2r5 C T 3: 64,411,339 (GRCm39) D410N probably damaging Het
Yap1 T C 9: 7,934,682 (GRCm39) D428G probably damaging Het
Zbed6 A G 1: 133,587,127 (GRCm39) I70T probably benign Het
Zfp157 A G 5: 138,455,191 (GRCm39) Y463C probably damaging Het
Other mutations in Chka
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00937:Chka APN 19 3,942,189 (GRCm39) missense probably benign 0.16
IGL02630:Chka APN 19 3,942,112 (GRCm39) missense possibly damaging 0.94
R1432:Chka UTSW 19 3,924,809 (GRCm39) splice site probably benign
R1840:Chka UTSW 19 3,936,460 (GRCm39) missense probably benign 0.00
R1898:Chka UTSW 19 3,942,205 (GRCm39) missense probably damaging 1.00
R3822:Chka UTSW 19 3,932,038 (GRCm39) intron probably benign
R4272:Chka UTSW 19 3,925,737 (GRCm39) splice site probably benign
R4329:Chka UTSW 19 3,925,803 (GRCm39) splice site probably benign
R4720:Chka UTSW 19 3,936,375 (GRCm39) missense probably damaging 0.99
R4923:Chka UTSW 19 3,942,105 (GRCm39) critical splice acceptor site probably null
R5783:Chka UTSW 19 3,914,661 (GRCm39) missense probably damaging 1.00
R5936:Chka UTSW 19 3,934,580 (GRCm39) missense probably benign 0.25
R5979:Chka UTSW 19 3,934,513 (GRCm39) missense probably damaging 1.00
R7429:Chka UTSW 19 3,942,787 (GRCm39) missense probably damaging 1.00
R7430:Chka UTSW 19 3,942,787 (GRCm39) missense probably damaging 1.00
R8189:Chka UTSW 19 3,925,759 (GRCm39) nonsense probably null
R8213:Chka UTSW 19 3,935,882 (GRCm39) missense probably damaging 1.00
R8397:Chka UTSW 19 3,902,414 (GRCm39) critical splice donor site probably null
R8440:Chka UTSW 19 3,943,375 (GRCm39) missense probably damaging 1.00
R9289:Chka UTSW 19 3,935,953 (GRCm39) missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- AACTGGTTCCTGGTTCTAAGG -3'
(R):5'- CCACCCACCTGATAGCAATTTTG -3'

Sequencing Primer
(F):5'- CTAAGGTGGTGCGGTCTTAGTACAG -3'
(R):5'- CTTGGTCCAGGAATTGATACATGC -3'
Posted On 2015-09-24