Mutagenetix > Incidental Mutation

Incidental Mutation 'R4573:Chka'

342306

Institutional Source

Beutler Lab

Gene Symbol

Chka

Ensembl Gene

ENSMUSG00000024843

Gene Name

choline kinase alpha

Synonyms

choline/ethanolamine kinase alpha, EtnK-alpha, CK/EK-alpha, Chk, ChoK

MMRRC Submission

041598-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4573 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

3851773-3894369 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 3885960 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Arginine at position 240 (K240R)

Ref Sequence

ENSEMBL: ENSMUSP00000025760 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025760] [ENSMUST00000072055] [ENSMUST00000128694] [ENSMUST00000153343]

AlphaFold

O54804

Predicted Effect

probably damaging
Transcript: ENSMUST00000025760
AA Change: K240R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000025760
Gene: ENSMUSG00000024843
AA Change: K240R

Domain	Start	End	E-Value	Type
low complexity region	13	24	N/A	INTRINSIC
low complexity region	53	74	N/A	INTRINSIC
Pfam:APH	108	373	2.4e-11	PFAM
Pfam:Choline_kinase	135	370	8.2e-82	PFAM
Pfam:EcKinase	211	345	2.5e-7	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000072055
AA Change: K222R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000071933
Gene: ENSMUSG00000024843
AA Change: K222R

Domain	Start	End	E-Value	Type
low complexity region	13	24	N/A	INTRINSIC
low complexity region	53	74	N/A	INTRINSIC
Pfam:APH	108	358	6.4e-12	PFAM
Pfam:Choline_kinase	135	352	1.6e-84	PFAM
Pfam:EcKinase	190	329	2e-7	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000125640
AA Change: K163R

SMART Domains

Protein: ENSMUSP00000119493
Gene: ENSMUSG00000024843
AA Change: K163R

Domain	Start	End	E-Value	Type
Pfam:Choline_kinase	40	230	2.2e-49	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125859

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127544

Predicted Effect

probably benign
Transcript: ENSMUST00000128694

SMART Domains

Protein: ENSMUSP00000119919
Gene: ENSMUSG00000024843

Domain	Start	End	E-Value	Type
PDB:4DA5\|B	1	150	2e-60	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000139655

SMART Domains

Protein: ENSMUSP00000116427
Gene: ENSMUSG00000024843

Domain	Start	End	E-Value	Type
low complexity region	5	16	N/A	INTRINSIC
PDB:4DA5\|B	17	160	3e-68	PDB

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146463

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148325

Predicted Effect

probably benign
Transcript: ENSMUST00000153343

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The major pathway for the biosynthesis of phosphatidylcholine occurs via the CDP-choline pathway. The protein encoded by this gene is the initial enzyme in the sequence and may play a regulatory role. The encoded protein also catalyzes the phosphorylation of ethanolamine. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality between E3.5 and E7.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam15	T	C	3: 89,345,986	E212G	probably damaging	Het
Adam1b	A	C	5: 121,500,793	S730A	probably benign	Het
Akr1b10	T	C	6: 34,392,129	V153A	probably damaging	Het
Ap1m2	T	C	9: 21,305,758	Y94C	probably damaging	Het
Arhgef33	T	C	17: 80,365,282	S320P	probably damaging	Het
Arsg	T	C	11: 109,517,282	S87P	probably damaging	Het
Asic3	A	G	5: 24,417,192	Y458C	probably damaging	Het
Aspm	G	T	1: 139,479,507	W2044L	probably damaging	Het
Atad2b	T	C	12: 4,954,663		probably null	Het
Atp1a2	T	C	1: 172,278,637	I869M	possibly damaging	Het
Bpifb2	C	T	2: 153,889,492	L263F	probably damaging	Het
C1s2	T	C	6: 124,628,243		probably null	Het
Carf	G	T	1: 60,148,112	A590S	probably benign	Het
Cbarp	G	T	10: 80,131,411	D658E	probably damaging	Het
Cd1d2	A	G	3: 86,987,554	I78V	probably benign	Het
Cdc42bpb	A	T	12: 111,323,141	M418K	probably benign	Het
Cdhr3	A	T	12: 33,068,153		probably null	Het
Cep290	A	G	10: 100,518,850	K932R	probably benign	Het
Ces1d	A	C	8: 93,181,534	N310K	probably benign	Het
Cltb	C	T	13: 54,598,761	R64H	probably damaging	Het
Cyp4f37	A	G	17: 32,629,087	E193G	probably benign	Het
Dhrs9	C	A	2: 69,397,641	H200N	probably benign	Het
Dnah6	T	A	6: 73,086,181	N2698I	probably damaging	Het
Dnah8	T	C	17: 30,700,406	S1118P	probably benign	Het
Dyrk1a	A	G	16: 94,692,023	Y705C	possibly damaging	Het
Elmod1	T	C	9: 53,925,972	N183S	probably damaging	Het
Fam129a	T	C	1: 151,703,766	V412A	possibly damaging	Het
Fer1l6	G	A	15: 58,626,280		probably null	Het
Fsip2	A	T	2: 82,986,166	Y4081F	possibly damaging	Het
Gm38394	A	G	1: 133,659,389	I70T	probably benign	Het
Gsr	A	G	8: 33,693,853	D381G	probably benign	Het
Gucy1a1	A	G	3: 82,108,922	L253S	possibly damaging	Het
Herc3	C	A	6: 58,894,113	T69K	possibly damaging	Het
Hoxb13	A	G	11: 96,194,951	Y170C	probably damaging	Het
Hsd3b5	T	C	3: 98,619,648	M161V	probably benign	Het
Lrp6	G	A	6: 134,470,730	R985*	probably null	Het
March5	T	A	19: 37,220,394	I154K	probably damaging	Het
Mcemp1	A	G	8: 3,665,835		probably null	Het
Mrpl2	G	T	17: 46,649,041	C212F	possibly damaging	Het
Mterf1a	G	A	5: 3,891,119	R250W	possibly damaging	Het
Mthfd1	A	G	12: 76,294,138		probably null	Het
Mul1	T	C	4: 138,436,349	F19L	probably benign	Het
Mycbp2	G	T	14: 103,346,297	A74E	probably benign	Het
Myo5a	A	T	9: 75,201,297		probably null	Het
Ncor2	A	T	5: 125,055,825	S33T	probably damaging	Het
Ninj1	A	G	13: 49,194,987	N191S	probably damaging	Het
Nrap	T	C	19: 56,342,338		probably null	Het
Ofcc1	G	A	13: 40,015,388	T841I	probably damaging	Het
Olfr353	T	C	2: 36,890,190	I219M	probably damaging	Het
Olfr50	T	A	2: 36,793,479	M81K	probably damaging	Het
Osbpl5	C	A	7: 143,694,316	V671L	probably benign	Het
Paics	T	C	5: 76,956,603	L25S	probably benign	Het
Pcmtd1	A	G	1: 7,120,367	E20G	probably damaging	Het
Pgbd5	G	A	8: 124,376,227	Q228*	probably null	Het
Pnpla7	T	C	2: 25,050,873	V1079A	probably damaging	Het
Pou2f1	G	A	1: 165,913,261	T113I	probably benign	Het
Ppp1r14c	A	G	10: 3,463,416	I150V	possibly damaging	Het
Ppp1r2	A	G	16: 31,260,637	Y115H	possibly damaging	Het
Ptchd4	T	C	17: 42,502,777	V523A	probably benign	Het
Rabep1	G	C	11: 70,917,751	S468T	probably damaging	Het
Rgs6	T	A	12: 83,066,015	W200R	probably damaging	Het
Ryr3	C	T	2: 112,755,174		probably null	Het
Scamp2	A	T	9: 57,577,194	D20V	probably damaging	Het
Sec24d	G	A	3: 123,358,870	V844M	probably damaging	Het
Sept10	T	A	10: 59,192,329	N57Y	probably damaging	Het
Sis	T	C	3: 72,928,237	K931E	possibly damaging	Het
Slamf7	T	C	1: 171,636,366	T258A	probably benign	Het
Slc15a1	A	G	14: 121,487,029	S144P	probably damaging	Het
Slc6a7	A	T	18: 61,002,181	V425E	probably benign	Het
Syt7	C	T	19: 10,439,212	R253*	probably null	Het
Tm4sf1	A	T	3: 57,294,785	C2S	possibly damaging	Het
Trio	CCTTCTTCTTCT	CCTTCTTCT	15: 27,772,998		probably benign	Het
Trpm3	C	T	19: 22,902,142	H594Y	probably damaging	Het
Tshz1	A	T	18: 84,015,082	N400K	probably damaging	Het
Vat1	A	T	11: 101,460,615	M300K	probably benign	Het
Vmn1r70	C	A	7: 10,633,629		probably null	Het
Vmn2r5	C	T	3: 64,503,918	D410N	probably damaging	Het
Yap1	T	C	9: 7,934,681	D428G	probably damaging	Het
Zfp157	A	G	5: 138,456,929	Y463C	probably damaging	Het

Other mutations in Chka

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00937:Chka	APN	19	3892189	missense	probably benign	0.16
IGL02630:Chka	APN	19	3892112	missense	possibly damaging	0.94
R1432:Chka	UTSW	19	3874809	splice site	probably benign
R1840:Chka	UTSW	19	3886460	missense	probably benign	0.00
R1898:Chka	UTSW	19	3892205	missense	probably damaging	1.00
R3822:Chka	UTSW	19	3882038	intron	probably benign
R4272:Chka	UTSW	19	3875737	splice site	probably benign
R4329:Chka	UTSW	19	3875803	splice site	probably benign
R4720:Chka	UTSW	19	3886375	missense	probably damaging	0.99
R4923:Chka	UTSW	19	3892105	critical splice acceptor site	probably null
R5783:Chka	UTSW	19	3864661	missense	probably damaging	1.00
R5936:Chka	UTSW	19	3884580	missense	probably benign	0.25
R5979:Chka	UTSW	19	3884513	missense	probably damaging	1.00
R7429:Chka	UTSW	19	3892787	missense	probably damaging	1.00
R7430:Chka	UTSW	19	3892787	missense	probably damaging	1.00
R8189:Chka	UTSW	19	3875759	nonsense	probably null
R8213:Chka	UTSW	19	3885882	missense	probably damaging	1.00
R8397:Chka	UTSW	19	3852414	critical splice donor site	probably null
R8440:Chka	UTSW	19	3893375	missense	probably damaging	1.00
R9289:Chka	UTSW	19	3885953	missense	possibly damaging	0.75

Predicted Primers

PCR Primer
(F):5'- AACTGGTTCCTGGTTCTAAGG -3'
(R):5'- CCACCCACCTGATAGCAATTTTG -3'

Sequencing Primer
(F):5'- CTAAGGTGGTGCGGTCTTAGTACAG -3'
(R):5'- CTTGGTCCAGGAATTGATACATGC -3'

Posted On

2015-09-24