Incidental Mutation 'R4574:Sumf1'
ID342333
Institutional Source Beutler Lab
Gene Symbol Sumf1
Ensembl Gene ENSMUSG00000030101
Gene Namesulfatase modifying factor 1
Synonyms
MMRRC Submission 041797-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock #R4574 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location108107028-108185582 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 108108432 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000132321 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032191] [ENSMUST00000167338] [ENSMUST00000172188]
Predicted Effect probably benign
Transcript: ENSMUST00000032191
SMART Domains Protein: ENSMUSP00000032191
Gene: ENSMUSG00000030101

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
low complexity region 40 51 N/A INTRINSIC
Pfam:FGE-sulfatase 85 365 1.4e-93 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166197
Predicted Effect probably benign
Transcript: ENSMUST00000167338
SMART Domains Protein: ENSMUSP00000127537
Gene: ENSMUSG00000030101

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
low complexity region 40 51 N/A INTRINSIC
Pfam:FGE-sulfatase 85 340 1.2e-93 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172188
SMART Domains Protein: ENSMUSP00000132321
Gene: ENSMUSG00000030101

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
low complexity region 40 51 N/A INTRINSIC
Pfam:FGE-sulfatase 85 149 9.5e-18 PFAM
Pfam:FGE-sulfatase 144 233 4.9e-30 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that catalyzes the hydrolysis of sulfate esters by oxidizing a cysteine residue in the substrate sulfatase to an active site 3-oxoalanine residue, which is also known as C-alpha-formylglycine. Mutations in this gene cause multiple sulfatase deficiency, a lysosomal storage disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygotes lacking all sulfatase activities exhibit frequent early postnatal lethality and growth retardation, skeletal anomalies, neurological defects, and massive GAG accumulation and cell vacuolization in all tissues in association with systemic inflammation, apoptosis, and neurodegeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik T A 10: 43,533,010 S46C probably damaging Het
Adam1b A C 5: 121,500,793 S730A probably benign Het
Adamts9 G A 6: 92,879,959 R319* probably null Het
Anapc1 G T 2: 128,627,195 S1575R probably damaging Het
Appbp2 A T 11: 85,209,938 probably null Het
Bcas2 C T 3: 103,174,350 P90S probably benign Het
Carmil3 GGACGA GGA 14: 55,499,476 probably benign Het
Cd101 T C 3: 101,013,153 N477D probably benign Het
Cdk12 A G 11: 98,220,988 probably benign Het
Clcn4 T C 7: 7,287,805 E634G probably benign Het
Cltb C T 13: 54,598,761 R64H probably damaging Het
Cpt1b G T 15: 89,424,044 probably null Het
Ctf2 T G 7: 127,719,384 T148P possibly damaging Het
Ddx23 G A 15: 98,647,624 T601I probably damaging Het
Dlx6 G T 6: 6,865,305 probably benign Het
Dmrtb1 A T 4: 107,677,068 N183K possibly damaging Het
Dnah11 A G 12: 118,012,255 probably null Het
Dnah5 C T 15: 28,367,763 P2765S probably benign Het
Dnah6 T A 6: 73,086,181 N2698I probably damaging Het
Fpr-rs6 T A 17: 20,183,097 M1L probably damaging Het
Gm4841 T C 18: 60,269,926 N365S probably benign Het
Gsdmc2 C T 15: 63,828,023 probably null Het
Irx5 G A 8: 92,358,262 V27I probably damaging Het
Kmt2e T A 5: 23,492,407 V101D possibly damaging Het
Maip1 A C 1: 57,413,245 K219Q possibly damaging Het
Mpp7 G T 18: 7,353,228 R493S probably benign Het
Ms4a14 T C 19: 11,303,971 T408A probably benign Het
Mthfr A G 4: 148,043,541 N117S possibly damaging Het
Myo5c A G 9: 75,269,611 I613V probably benign Het
Neurl1b A G 17: 26,431,886 Q44R probably benign Het
Nup54 T A 5: 92,425,782 N187I probably benign Het
Ofcc1 G A 13: 40,015,388 T841I probably damaging Het
Olfr992 C A 2: 85,400,026 C169F probably damaging Het
Pate2 C A 9: 35,685,673 probably benign Het
Pccb T C 9: 100,985,199 S445G probably damaging Het
Pex3 G A 10: 13,535,571 Q188* probably null Het
Pikfyve T A 1: 65,192,192 W74R probably damaging Het
Plcl2 T C 17: 50,607,846 S628P probably damaging Het
Pnldc1 T C 17: 12,892,782 H346R probably benign Het
Pom121l2 T A 13: 21,984,402 C948S probably benign Het
Pspc1 A T 14: 56,761,947 M284K possibly damaging Het
Ralgapa2 A G 2: 146,435,999 L414S probably damaging Het
Rgs13 T A 1: 144,140,845 K53N probably damaging Het
Rorc T C 3: 94,388,984 S163P probably benign Het
Rpl3l A C 17: 24,734,010 T315P possibly damaging Het
Rsph3b A G 17: 6,905,039 V487A probably benign Het
Rusc2 A G 4: 43,416,080 E462G probably damaging Het
Sez6l T C 5: 112,428,478 T838A probably damaging Het
Slc22a14 A G 9: 119,179,495 Y236H probably damaging Het
Sspo G A 6: 48,465,523 R1984H probably damaging Het
Steap3 G T 1: 120,241,456 D370E probably benign Het
Telo2 T C 17: 25,101,673 E754G probably damaging Het
Tjp1 A G 7: 65,322,605 F604L probably damaging Het
Trpm7 A T 2: 126,797,211 D1734E probably benign Het
Tsfm A C 10: 127,028,373 Y158D probably damaging Het
Ubtf T C 11: 102,306,765 probably benign Het
Upk3a G T 15: 85,020,551 V167F possibly damaging Het
Vmn2r19 C T 6: 123,315,980 S327L probably benign Het
Vps13c T A 9: 67,951,683 I2805N probably damaging Het
Zfp592 A G 7: 81,023,786 D166G possibly damaging Het
Other mutations in Sumf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01112:Sumf1 APN 6 108176016 missense probably damaging 1.00
IGL01624:Sumf1 APN 6 108153201 missense probably damaging 1.00
IGL02146:Sumf1 APN 6 108173431 critical splice acceptor site probably null
R0594:Sumf1 UTSW 6 108173414 missense probably benign 0.31
R0633:Sumf1 UTSW 6 108144671 missense probably damaging 1.00
R1479:Sumf1 UTSW 6 108176058 missense probably damaging 1.00
R3036:Sumf1 UTSW 6 108153191 missense possibly damaging 0.92
R3054:Sumf1 UTSW 6 108153204 missense probably benign 0.14
R4246:Sumf1 UTSW 6 108155013 missense probably damaging 1.00
R4247:Sumf1 UTSW 6 108155013 missense probably damaging 1.00
R4249:Sumf1 UTSW 6 108155013 missense probably damaging 1.00
R4853:Sumf1 UTSW 6 108185495 missense probably benign 0.00
R5146:Sumf1 UTSW 6 108185310 missense probably benign 0.12
R5764:Sumf1 UTSW 6 108118463 intron probably benign
Predicted Primers PCR Primer
(F):5'- GGCTTTCAAAGTAAAACATGGCG -3'
(R):5'- TAACGTAAGCCCTAAGCCAAGG -3'

Sequencing Primer
(F):5'- TGGCGATGATCCCCAAAG -3'
(R):5'- CAAGGGTTCCAGGATCTCTTACG -3'
Posted On2015-09-24