Incidental Mutation 'R4574:Tjp1'
ID342336
Institutional Source Beutler Lab
Gene Symbol Tjp1
Ensembl Gene ENSMUSG00000030516
Gene Nametight junction protein 1
SynonymsZO1, ZO-1
MMRRC Submission 041797-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4574 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location65296165-65527781 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 65322605 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 604 (F604L)
Ref Sequence ENSEMBL: ENSMUSP00000099652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032729] [ENSMUST00000102592] [ENSMUST00000206612]
PDB Structure Interplay between phosphatidyl-inositol-phosphates and claudins upon binding to the 1st PDZ domain of zonula occludens 1 [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000032729
AA Change: F604L

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000032729
Gene: ENSMUSG00000030516
AA Change: F604L

DomainStartEndE-ValueType
low complexity region 1 17 N/A INTRINSIC
PDZ 32 110 1.65e-15 SMART
PDZ 196 264 3.92e-17 SMART
low complexity region 302 324 N/A INTRINSIC
PDZ 431 504 5.94e-17 SMART
SH3 519 583 6.41e-2 SMART
GuKc 606 794 1.28e-49 SMART
low complexity region 810 824 N/A INTRINSIC
low complexity region 893 906 N/A INTRINSIC
low complexity region 1157 1176 N/A INTRINSIC
low complexity region 1246 1257 N/A INTRINSIC
low complexity region 1308 1319 N/A INTRINSIC
low complexity region 1339 1365 N/A INTRINSIC
low complexity region 1389 1400 N/A INTRINSIC
ZU5 1549 1654 1.1e-56 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102592
AA Change: F604L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099652
Gene: ENSMUSG00000030516
AA Change: F604L

DomainStartEndE-ValueType
low complexity region 1 17 N/A INTRINSIC
PDZ 32 110 1.65e-15 SMART
PDZ 196 264 3.92e-17 SMART
low complexity region 302 324 N/A INTRINSIC
PDZ 431 504 5.94e-17 SMART
SH3 519 583 6.41e-2 SMART
GuKc 606 794 1.28e-49 SMART
low complexity region 810 824 N/A INTRINSIC
low complexity region 893 906 N/A INTRINSIC
low complexity region 939 955 N/A INTRINSIC
low complexity region 1237 1256 N/A INTRINSIC
low complexity region 1326 1337 N/A INTRINSIC
low complexity region 1388 1399 N/A INTRINSIC
low complexity region 1419 1445 N/A INTRINSIC
low complexity region 1469 1480 N/A INTRINSIC
ZU5 1629 1735 1.84e-58 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000206612
AA Change: F604L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.0817 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein located on a cytoplasmic membrane surface of intercellular tight junctions. The encoded protein may be involved in signal transduction at cell-cell junctions. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a null allele show embryonic lethality and growth retardation, failure of embryo turning and chorioallantoic fusion, defective yolk sac angiogenesis, and increased apoptosis in the notochord, neural tube, somite and allantois. Homozygotes for a reporter allele are overtly normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik T A 10: 43,533,010 S46C probably damaging Het
Adam1b A C 5: 121,500,793 S730A probably benign Het
Adamts9 G A 6: 92,879,959 R319* probably null Het
Anapc1 G T 2: 128,627,195 S1575R probably damaging Het
Appbp2 A T 11: 85,209,938 probably null Het
Bcas2 C T 3: 103,174,350 P90S probably benign Het
Carmil3 GGACGA GGA 14: 55,499,476 probably benign Het
Cd101 T C 3: 101,013,153 N477D probably benign Het
Cdk12 A G 11: 98,220,988 probably benign Het
Clcn4 T C 7: 7,287,805 E634G probably benign Het
Cltb C T 13: 54,598,761 R64H probably damaging Het
Cpt1b G T 15: 89,424,044 probably null Het
Ctf2 T G 7: 127,719,384 T148P possibly damaging Het
Ddx23 G A 15: 98,647,624 T601I probably damaging Het
Dlx6 G T 6: 6,865,305 probably benign Het
Dmrtb1 A T 4: 107,677,068 N183K possibly damaging Het
Dnah11 A G 12: 118,012,255 probably null Het
Dnah5 C T 15: 28,367,763 P2765S probably benign Het
Dnah6 T A 6: 73,086,181 N2698I probably damaging Het
Fpr-rs6 T A 17: 20,183,097 M1L probably damaging Het
Gm4841 T C 18: 60,269,926 N365S probably benign Het
Gsdmc2 C T 15: 63,828,023 probably null Het
Irx5 G A 8: 92,358,262 V27I probably damaging Het
Kmt2e T A 5: 23,492,407 V101D possibly damaging Het
Maip1 A C 1: 57,413,245 K219Q possibly damaging Het
Mpp7 G T 18: 7,353,228 R493S probably benign Het
Ms4a14 T C 19: 11,303,971 T408A probably benign Het
Mthfr A G 4: 148,043,541 N117S possibly damaging Het
Myo5c A G 9: 75,269,611 I613V probably benign Het
Neurl1b A G 17: 26,431,886 Q44R probably benign Het
Nup54 T A 5: 92,425,782 N187I probably benign Het
Ofcc1 G A 13: 40,015,388 T841I probably damaging Het
Olfr992 C A 2: 85,400,026 C169F probably damaging Het
Pate2 C A 9: 35,685,673 probably benign Het
Pccb T C 9: 100,985,199 S445G probably damaging Het
Pex3 G A 10: 13,535,571 Q188* probably null Het
Pikfyve T A 1: 65,192,192 W74R probably damaging Het
Plcl2 T C 17: 50,607,846 S628P probably damaging Het
Pnldc1 T C 17: 12,892,782 H346R probably benign Het
Pom121l2 T A 13: 21,984,402 C948S probably benign Het
Pspc1 A T 14: 56,761,947 M284K possibly damaging Het
Ralgapa2 A G 2: 146,435,999 L414S probably damaging Het
Rgs13 T A 1: 144,140,845 K53N probably damaging Het
Rorc T C 3: 94,388,984 S163P probably benign Het
Rpl3l A C 17: 24,734,010 T315P possibly damaging Het
Rsph3b A G 17: 6,905,039 V487A probably benign Het
Rusc2 A G 4: 43,416,080 E462G probably damaging Het
Sez6l T C 5: 112,428,478 T838A probably damaging Het
Slc22a14 A G 9: 119,179,495 Y236H probably damaging Het
Sspo G A 6: 48,465,523 R1984H probably damaging Het
Steap3 G T 1: 120,241,456 D370E probably benign Het
Sumf1 A G 6: 108,108,432 probably benign Het
Telo2 T C 17: 25,101,673 E754G probably damaging Het
Trpm7 A T 2: 126,797,211 D1734E probably benign Het
Tsfm A C 10: 127,028,373 Y158D probably damaging Het
Ubtf T C 11: 102,306,765 probably benign Het
Upk3a G T 15: 85,020,551 V167F possibly damaging Het
Vmn2r19 C T 6: 123,315,980 S327L probably benign Het
Vps13c T A 9: 67,951,683 I2805N probably damaging Het
Zfp592 A G 7: 81,023,786 D166G possibly damaging Het
Other mutations in Tjp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Tjp1 APN 7 65301219 missense probably benign
IGL00848:Tjp1 APN 7 65303194 missense probably benign 0.00
IGL01363:Tjp1 APN 7 65302965 missense possibly damaging 0.94
IGL01526:Tjp1 APN 7 65322658 missense probably damaging 1.00
IGL01607:Tjp1 APN 7 65336178 missense possibly damaging 0.94
IGL02223:Tjp1 APN 7 65322601 missense probably damaging 1.00
IGL02341:Tjp1 APN 7 65312634 missense probably damaging 1.00
IGL02347:Tjp1 APN 7 65301064 critical splice donor site probably null
IGL02452:Tjp1 APN 7 65312655 missense probably damaging 1.00
IGL02512:Tjp1 APN 7 65343667 missense probably damaging 1.00
IGL02552:Tjp1 APN 7 65299782 nonsense probably null
IGL02707:Tjp1 APN 7 65329683 nonsense probably null
IGL02707:Tjp1 APN 7 65329682 missense possibly damaging 0.85
IGL02939:Tjp1 APN 7 65314890 missense probably damaging 1.00
IGL03139:Tjp1 APN 7 65340434 splice site probably benign
IGL03273:Tjp1 APN 7 65299799 missense probably damaging 1.00
IGL03391:Tjp1 APN 7 65314969 missense probably damaging 1.00
PIT4453001:Tjp1 UTSW 7 65343614 critical splice donor site probably null
R0012:Tjp1 UTSW 7 65329775 splice site probably benign
R0012:Tjp1 UTSW 7 65329775 splice site probably benign
R0390:Tjp1 UTSW 7 65314990 missense probably damaging 1.00
R0519:Tjp1 UTSW 7 65302921 missense probably benign
R0653:Tjp1 UTSW 7 65314755 missense probably damaging 1.00
R1163:Tjp1 UTSW 7 65323054 missense probably damaging 1.00
R1544:Tjp1 UTSW 7 65302921 missense probably benign
R1634:Tjp1 UTSW 7 65302952 missense possibly damaging 0.94
R1767:Tjp1 UTSW 7 65312553 critical splice donor site probably null
R1771:Tjp1 UTSW 7 65313005 missense probably benign 0.45
R1794:Tjp1 UTSW 7 65323129 missense probably damaging 1.00
R1874:Tjp1 UTSW 7 65319253 missense probably damaging 1.00
R1971:Tjp1 UTSW 7 65324078 missense probably damaging 1.00
R1981:Tjp1 UTSW 7 65312855 missense probably damaging 0.99
R2086:Tjp1 UTSW 7 65312921 missense probably damaging 1.00
R2310:Tjp1 UTSW 7 65329742 missense possibly damaging 0.90
R2942:Tjp1 UTSW 7 65318006 missense probably damaging 1.00
R3974:Tjp1 UTSW 7 65297639 nonsense probably null
R4295:Tjp1 UTSW 7 65323150 missense probably damaging 1.00
R4296:Tjp1 UTSW 7 65318489 missense probably damaging 1.00
R4567:Tjp1 UTSW 7 65306501 missense probably damaging 1.00
R4910:Tjp1 UTSW 7 65343727 missense probably damaging 1.00
R4958:Tjp1 UTSW 7 65336102 nonsense probably null
R5267:Tjp1 UTSW 7 65323049 missense probably damaging 1.00
R5371:Tjp1 UTSW 7 65313311 nonsense probably null
R5422:Tjp1 UTSW 7 65302967 missense probably damaging 0.99
R5514:Tjp1 UTSW 7 65354861 missense probably damaging 1.00
R5652:Tjp1 UTSW 7 65312443 splice site probably null
R5693:Tjp1 UTSW 7 65342663 missense possibly damaging 0.96
R5933:Tjp1 UTSW 7 65302852 missense probably benign 0.29
R6043:Tjp1 UTSW 7 65324089 missense probably damaging 1.00
R6416:Tjp1 UTSW 7 65313205 missense possibly damaging 0.76
R6491:Tjp1 UTSW 7 65337117 missense possibly damaging 0.62
R6525:Tjp1 UTSW 7 65343651 missense probably damaging 1.00
R6658:Tjp1 UTSW 7 65301077 missense possibly damaging 0.82
R6917:Tjp1 UTSW 7 65299688 missense probably damaging 0.99
R6960:Tjp1 UTSW 7 65303015 missense possibly damaging 0.59
R7235:Tjp1 UTSW 7 65318573 missense probably benign 0.16
R7274:Tjp1 UTSW 7 65527652 missense possibly damaging 0.86
R7471:Tjp1 UTSW 7 65314690 missense probably damaging 0.99
R7475:Tjp1 UTSW 7 65322339 missense probably damaging 1.00
R7479:Tjp1 UTSW 7 65301180 missense probably damaging 0.98
R8035:Tjp1 UTSW 7 65342702 missense probably benign 0.34
R8195:Tjp1 UTSW 7 65343722 missense probably damaging 1.00
R8276:Tjp1 UTSW 7 65343796 intron probably benign
R8817:Tjp1 UTSW 7 65303062 missense probably benign 0.41
R8869:Tjp1 UTSW 7 65336638 missense probably damaging 1.00
X0022:Tjp1 UTSW 7 65302841 missense possibly damaging 0.75
X0027:Tjp1 UTSW 7 65314759 missense probably benign 0.18
Z1177:Tjp1 UTSW 7 65343732 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCACTTCCTGAAACATACTGC -3'
(R):5'- CGTCTAACTGACTCGCTCAATC -3'

Sequencing Primer
(F):5'- TTCCTGAAACATACTGCCATGAAG -3'
(R):5'- CCTTTGAAATGAAAGGTGCATGTG -3'
Posted On2015-09-24