Mutagenetix > Incidental Mutation

Incidental Mutation 'R4574:Zfp592'

342337

Institutional Source

Beutler Lab

Gene Symbol

Zfp592

Ensembl Gene

ENSMUSG00000005621

Gene Name

zinc finger protein 592

Synonyms

MMRRC Submission

041797-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.934) question?

Stock #

R4574 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

80993681-81045164 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 81023786 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 166 (D166G)

Ref Sequence

ENSEMBL: ENSMUSP00000102976 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000107353]

AlphaFold

Q8BHZ4

Predicted Effect

possibly damaging
Transcript: ENSMUST00000107353
AA Change: D166G

PolyPhen 2 Score 0.865 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000102976
Gene: ENSMUSG00000005621
AA Change: D166G

Domain	Start	End	E-Value	Type
low complexity region	170	180	N/A	INTRINSIC
low complexity region	200	211	N/A	INTRINSIC
low complexity region	314	333	N/A	INTRINSIC
low complexity region	343	369	N/A	INTRINSIC
low complexity region	484	500	N/A	INTRINSIC
low complexity region	514	525	N/A	INTRINSIC
ZnF_C2H2	587	612	8.98e0	SMART
ZnF_C2H2	615	639	2.61e1	SMART
low complexity region	664	686	N/A	INTRINSIC
ZnF_C2H2	711	731	1.24e2	SMART
ZnF_C2H2	740	762	2.82e0	SMART
ZnF_C2H2	768	792	4.99e1	SMART
ZnF_C2H2	799	822	1.73e0	SMART
ZnF_C2H2	827	850	7.89e0	SMART
ZnF_C2H2	892	915	3.89e-3	SMART
low complexity region	924	935	N/A	INTRINSIC
low complexity region	965	979	N/A	INTRINSIC
ZnF_C2H2	983	1006	4.11e-2	SMART
ZnF_C2H2	1013	1036	7.37e-4	SMART
ZnF_C2H2	1043	1069	7.68e0	SMART
ZnF_C2H2	1124	1146	1.51e0	SMART
ZnF_C2H2	1153	1176	1.23e0	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176477

Meta Mutation Damage Score

0.0836

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

97% (63/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is thought to play a role in a complex developmental pathway and the regulation of genes involved in cerebellar development. Mutations in this gene have been associated with autosomal recessive spinocerebellar ataxia. [provided by RefSeq, Jan 2011]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700021F05Rik	T	A	10: 43,533,010	S46C	probably damaging	Het
Adam1b	A	C	5: 121,500,793	S730A	probably benign	Het
Adamts9	G	A	6: 92,879,959	R319*	probably null	Het
Anapc1	G	T	2: 128,627,195	S1575R	probably damaging	Het
Appbp2	A	T	11: 85,209,938		probably null	Het
Bcas2	C	T	3: 103,174,350	P90S	probably benign	Het
Carmil3	GGACGA	GGA	14: 55,499,476		probably benign	Het
Cd101	T	C	3: 101,013,153	N477D	probably benign	Het
Cdk12	A	G	11: 98,220,988		probably benign	Het
Clcn4	T	C	7: 7,287,805	E634G	probably benign	Het
Cltb	C	T	13: 54,598,761	R64H	probably damaging	Het
Cpt1b	G	T	15: 89,424,044		probably null	Het
Ctf2	T	G	7: 127,719,384	T148P	possibly damaging	Het
Ddx23	G	A	15: 98,647,624	T601I	probably damaging	Het
Dlx6	G	T	6: 6,865,305		probably benign	Het
Dmrtb1	A	T	4: 107,677,068	N183K	possibly damaging	Het
Dnah11	A	G	12: 118,012,255		probably null	Het
Dnah5	C	T	15: 28,367,763	P2765S	probably benign	Het
Dnah6	T	A	6: 73,086,181	N2698I	probably damaging	Het
Fpr-rs6	T	A	17: 20,183,097	M1L	probably damaging	Het
Gm4841	T	C	18: 60,269,926	N365S	probably benign	Het
Gsdmc2	C	T	15: 63,828,023		probably null	Het
Irx5	G	A	8: 92,358,262	V27I	probably damaging	Het
Kmt2e	T	A	5: 23,492,407	V101D	possibly damaging	Het
Maip1	A	C	1: 57,413,245	K219Q	possibly damaging	Het
Mpp7	G	T	18: 7,353,228	R493S	probably benign	Het
Ms4a14	T	C	19: 11,303,971	T408A	probably benign	Het
Mthfr	A	G	4: 148,043,541	N117S	possibly damaging	Het
Myo5c	A	G	9: 75,269,611	I613V	probably benign	Het
Neurl1b	A	G	17: 26,431,886	Q44R	probably benign	Het
Nup54	T	A	5: 92,425,782	N187I	probably benign	Het
Ofcc1	G	A	13: 40,015,388	T841I	probably damaging	Het
Olfr992	C	A	2: 85,400,026	C169F	probably damaging	Het
Pate2	C	A	9: 35,685,673		probably benign	Het
Pccb	T	C	9: 100,985,199	S445G	probably damaging	Het
Pex3	G	A	10: 13,535,571	Q188*	probably null	Het
Pikfyve	T	A	1: 65,192,192	W74R	probably damaging	Het
Plcl2	T	C	17: 50,607,846	S628P	probably damaging	Het
Pnldc1	T	C	17: 12,892,782	H346R	probably benign	Het
Pom121l2	T	A	13: 21,984,402	C948S	probably benign	Het
Pspc1	A	T	14: 56,761,947	M284K	possibly damaging	Het
Ralgapa2	A	G	2: 146,435,999	L414S	probably damaging	Het
Rgs13	T	A	1: 144,140,845	K53N	probably damaging	Het
Rorc	T	C	3: 94,388,984	S163P	probably benign	Het
Rpl3l	A	C	17: 24,734,010	T315P	possibly damaging	Het
Rsph3b	A	G	17: 6,905,039	V487A	probably benign	Het
Rusc2	A	G	4: 43,416,080	E462G	probably damaging	Het
Sez6l	T	C	5: 112,428,478	T838A	probably damaging	Het
Slc22a14	A	G	9: 119,179,495	Y236H	probably damaging	Het
Sspo	G	A	6: 48,465,523	R1984H	probably damaging	Het
Steap3	G	T	1: 120,241,456	D370E	probably benign	Het
Sumf1	A	G	6: 108,108,432		probably benign	Het
Telo2	T	C	17: 25,101,673	E754G	probably damaging	Het
Tjp1	A	G	7: 65,322,605	F604L	probably damaging	Het
Trpm7	A	T	2: 126,797,211	D1734E	probably benign	Het
Tsfm	A	C	10: 127,028,373	Y158D	probably damaging	Het
Ubtf	T	C	11: 102,306,765		probably benign	Het
Upk3a	G	T	15: 85,020,551	V167F	possibly damaging	Het
Vmn2r19	C	T	6: 123,315,980	S327L	probably benign	Het
Vps13c	T	A	9: 67,951,683	I2805N	probably damaging	Het

Other mutations in Zfp592

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01331:Zfp592	APN	7	81041548	nonsense	probably null
IGL01984:Zfp592	APN	7	81038644	missense	probably benign	0.00
IGL02079:Zfp592	APN	7	81039230	missense	probably benign	0.20
IGL02096:Zfp592	APN	7	81025048	missense	probably damaging	1.00
IGL02125:Zfp592	APN	7	81038184	missense	probably benign	0.00
IGL02374:Zfp592	APN	7	81024983	missense	probably damaging	1.00
IGL02419:Zfp592	APN	7	81038245	missense	probably damaging	1.00
IGL02466:Zfp592	APN	7	81023998	missense	probably damaging	1.00
IGL02485:Zfp592	APN	7	81037970	splice site	probably benign
IGL02500:Zfp592	APN	7	81041726	missense	probably benign
IGL02876:Zfp592	APN	7	81038127	missense	probably benign	0.01
IGL02940:Zfp592	APN	7	81024827	missense	probably damaging	1.00
R0326:Zfp592	UTSW	7	81024889	missense	possibly damaging	0.83
R0634:Zfp592	UTSW	7	81038071	missense	probably damaging	1.00
R0684:Zfp592	UTSW	7	81037875	missense	probably benign	0.00
R0750:Zfp592	UTSW	7	81024745	missense	probably benign
R1346:Zfp592	UTSW	7	81038064	missense	possibly damaging	0.54
R1457:Zfp592	UTSW	7	81024479	missense	probably damaging	0.99
R1650:Zfp592	UTSW	7	81038100	missense	probably benign	0.04
R1804:Zfp592	UTSW	7	81023695	missense	probably damaging	1.00
R1918:Zfp592	UTSW	7	81037420	nonsense	probably null
R2114:Zfp592	UTSW	7	81024796	missense	probably damaging	1.00
R2144:Zfp592	UTSW	7	81038202	missense	probably benign	0.01
R2164:Zfp592	UTSW	7	81041438	missense	possibly damaging	0.87
R2246:Zfp592	UTSW	7	81041613	missense	possibly damaging	0.91
R3701:Zfp592	UTSW	7	81037411	nonsense	probably null
R3809:Zfp592	UTSW	7	81024532	missense	probably benign	0.00
R4866:Zfp592	UTSW	7	81041859	missense	probably damaging	1.00
R5023:Zfp592	UTSW	7	81024347	missense	probably damaging	1.00
R5121:Zfp592	UTSW	7	81023561	missense	probably damaging	1.00
R5174:Zfp592	UTSW	7	81038325	missense	probably damaging	1.00
R5794:Zfp592	UTSW	7	81025033	missense	probably benign	0.00
R5946:Zfp592	UTSW	7	81037897	missense	possibly damaging	0.95
R6312:Zfp592	UTSW	7	81023436	missense	probably benign	0.05
R6657:Zfp592	UTSW	7	81025486	missense	possibly damaging	0.49
R6814:Zfp592	UTSW	7	81023828	missense	probably benign	0.02
R6872:Zfp592	UTSW	7	81023828	missense	probably benign	0.02
R7056:Zfp592	UTSW	7	81023319	missense	probably damaging	1.00
R7295:Zfp592	UTSW	7	81024322	missense	probably damaging	1.00
R7351:Zfp592	UTSW	7	81041691	missense	probably benign	0.00
R7475:Zfp592	UTSW	7	81023452	missense	probably damaging	0.99
R7509:Zfp592	UTSW	7	81038340	missense	probably damaging	0.99
R7552:Zfp592	UTSW	7	81023642	missense	probably benign	0.01
R7737:Zfp592	UTSW	7	81025193	missense	probably damaging	1.00
R7752:Zfp592	UTSW	7	81024721	missense	probably benign	0.13
R7901:Zfp592	UTSW	7	81024721	missense	probably benign	0.13
R8100:Zfp592	UTSW	7	81024192	missense	probably benign	0.05
R8440:Zfp592	UTSW	7	81041523	missense	possibly damaging	0.89
R8710:Zfp592	UTSW	7	81023573	missense	probably damaging	1.00
R8766:Zfp592	UTSW	7	81024605	missense	probably benign	0.00
R9083:Zfp592	UTSW	7	81024896	missense	possibly damaging	0.95
R9141:Zfp592	UTSW	7	81024457	missense	probably damaging	1.00
R9194:Zfp592	UTSW	7	81024601	missense	probably benign
R9197:Zfp592	UTSW	7	81024319	missense	possibly damaging	0.73
R9246:Zfp592	UTSW	7	81041781	missense	probably benign	0.03
R9321:Zfp592	UTSW	7	81041478	missense	possibly damaging	0.65
R9426:Zfp592	UTSW	7	81024457	missense	probably damaging	1.00
R9785:Zfp592	UTSW	7	81023497	missense	probably damaging	1.00
X0022:Zfp592	UTSW	7	81038187	nonsense	probably null
X0028:Zfp592	UTSW	7	81024014	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CATAATGGATTCCGGGGCTC -3'
(R):5'- GATCTTTGTGAGGCTCCACCAC -3'

Sequencing Primer
(F):5'- CACCACTGTGGGAAGTTTGATTCTAC -3'
(R):5'- GTGAGGCTCCACCACCTTCTG -3'

Posted On

2015-09-24