Incidental Mutation 'R4574:Zfp592'
ID342337
Institutional Source Beutler Lab
Gene Symbol Zfp592
Ensembl Gene ENSMUSG00000005621
Gene Namezinc finger protein 592
Synonyms
MMRRC Submission 041797-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.914) question?
Stock #R4574 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location80993681-81045164 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 81023786 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 166 (D166G)
Ref Sequence ENSEMBL: ENSMUSP00000102976 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107353]
Predicted Effect possibly damaging
Transcript: ENSMUST00000107353
AA Change: D166G

PolyPhen 2 Score 0.865 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000102976
Gene: ENSMUSG00000005621
AA Change: D166G

DomainStartEndE-ValueType
low complexity region 170 180 N/A INTRINSIC
low complexity region 200 211 N/A INTRINSIC
low complexity region 314 333 N/A INTRINSIC
low complexity region 343 369 N/A INTRINSIC
low complexity region 484 500 N/A INTRINSIC
low complexity region 514 525 N/A INTRINSIC
ZnF_C2H2 587 612 8.98e0 SMART
ZnF_C2H2 615 639 2.61e1 SMART
low complexity region 664 686 N/A INTRINSIC
ZnF_C2H2 711 731 1.24e2 SMART
ZnF_C2H2 740 762 2.82e0 SMART
ZnF_C2H2 768 792 4.99e1 SMART
ZnF_C2H2 799 822 1.73e0 SMART
ZnF_C2H2 827 850 7.89e0 SMART
ZnF_C2H2 892 915 3.89e-3 SMART
low complexity region 924 935 N/A INTRINSIC
low complexity region 965 979 N/A INTRINSIC
ZnF_C2H2 983 1006 4.11e-2 SMART
ZnF_C2H2 1013 1036 7.37e-4 SMART
ZnF_C2H2 1043 1069 7.68e0 SMART
ZnF_C2H2 1124 1146 1.51e0 SMART
ZnF_C2H2 1153 1176 1.23e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176477
Meta Mutation Damage Score 0.0836 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is thought to play a role in a complex developmental pathway and the regulation of genes involved in cerebellar development. Mutations in this gene have been associated with autosomal recessive spinocerebellar ataxia. [provided by RefSeq, Jan 2011]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik T A 10: 43,533,010 S46C probably damaging Het
Adam1b A C 5: 121,500,793 S730A probably benign Het
Adamts9 G A 6: 92,879,959 R319* probably null Het
Anapc1 G T 2: 128,627,195 S1575R probably damaging Het
Appbp2 A T 11: 85,209,938 probably null Het
Bcas2 C T 3: 103,174,350 P90S probably benign Het
Carmil3 GGACGA GGA 14: 55,499,476 probably benign Het
Cd101 T C 3: 101,013,153 N477D probably benign Het
Cdk12 A G 11: 98,220,988 probably benign Het
Clcn4 T C 7: 7,287,805 E634G probably benign Het
Cltb C T 13: 54,598,761 R64H probably damaging Het
Cpt1b G T 15: 89,424,044 probably null Het
Ctf2 T G 7: 127,719,384 T148P possibly damaging Het
Ddx23 G A 15: 98,647,624 T601I probably damaging Het
Dlx6 G T 6: 6,865,305 probably benign Het
Dmrtb1 A T 4: 107,677,068 N183K possibly damaging Het
Dnah11 A G 12: 118,012,255 probably null Het
Dnah5 C T 15: 28,367,763 P2765S probably benign Het
Dnah6 T A 6: 73,086,181 N2698I probably damaging Het
Fpr-rs6 T A 17: 20,183,097 M1L probably damaging Het
Gm4841 T C 18: 60,269,926 N365S probably benign Het
Gsdmc2 C T 15: 63,828,023 probably null Het
Irx5 G A 8: 92,358,262 V27I probably damaging Het
Kmt2e T A 5: 23,492,407 V101D possibly damaging Het
Maip1 A C 1: 57,413,245 K219Q possibly damaging Het
Mpp7 G T 18: 7,353,228 R493S probably benign Het
Ms4a14 T C 19: 11,303,971 T408A probably benign Het
Mthfr A G 4: 148,043,541 N117S possibly damaging Het
Myo5c A G 9: 75,269,611 I613V probably benign Het
Neurl1b A G 17: 26,431,886 Q44R probably benign Het
Nup54 T A 5: 92,425,782 N187I probably benign Het
Ofcc1 G A 13: 40,015,388 T841I probably damaging Het
Olfr992 C A 2: 85,400,026 C169F probably damaging Het
Pate2 C A 9: 35,685,673 probably benign Het
Pccb T C 9: 100,985,199 S445G probably damaging Het
Pex3 G A 10: 13,535,571 Q188* probably null Het
Pikfyve T A 1: 65,192,192 W74R probably damaging Het
Plcl2 T C 17: 50,607,846 S628P probably damaging Het
Pnldc1 T C 17: 12,892,782 H346R probably benign Het
Pom121l2 T A 13: 21,984,402 C948S probably benign Het
Pspc1 A T 14: 56,761,947 M284K possibly damaging Het
Ralgapa2 A G 2: 146,435,999 L414S probably damaging Het
Rgs13 T A 1: 144,140,845 K53N probably damaging Het
Rorc T C 3: 94,388,984 S163P probably benign Het
Rpl3l A C 17: 24,734,010 T315P possibly damaging Het
Rsph3b A G 17: 6,905,039 V487A probably benign Het
Rusc2 A G 4: 43,416,080 E462G probably damaging Het
Sez6l T C 5: 112,428,478 T838A probably damaging Het
Slc22a14 A G 9: 119,179,495 Y236H probably damaging Het
Sspo G A 6: 48,465,523 R1984H probably damaging Het
Steap3 G T 1: 120,241,456 D370E probably benign Het
Sumf1 A G 6: 108,108,432 probably benign Het
Telo2 T C 17: 25,101,673 E754G probably damaging Het
Tjp1 A G 7: 65,322,605 F604L probably damaging Het
Trpm7 A T 2: 126,797,211 D1734E probably benign Het
Tsfm A C 10: 127,028,373 Y158D probably damaging Het
Ubtf T C 11: 102,306,765 probably benign Het
Upk3a G T 15: 85,020,551 V167F possibly damaging Het
Vmn2r19 C T 6: 123,315,980 S327L probably benign Het
Vps13c T A 9: 67,951,683 I2805N probably damaging Het
Other mutations in Zfp592
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01331:Zfp592 APN 7 81041548 nonsense probably null
IGL01984:Zfp592 APN 7 81038644 missense probably benign 0.00
IGL02079:Zfp592 APN 7 81039230 missense probably benign 0.20
IGL02096:Zfp592 APN 7 81025048 missense probably damaging 1.00
IGL02125:Zfp592 APN 7 81038184 missense probably benign 0.00
IGL02374:Zfp592 APN 7 81024983 missense probably damaging 1.00
IGL02419:Zfp592 APN 7 81038245 missense probably damaging 1.00
IGL02466:Zfp592 APN 7 81023998 missense probably damaging 1.00
IGL02485:Zfp592 APN 7 81037970 splice site probably benign
IGL02500:Zfp592 APN 7 81041726 missense probably benign
IGL02876:Zfp592 APN 7 81038127 missense probably benign 0.01
IGL02940:Zfp592 APN 7 81024827 missense probably damaging 1.00
R0326:Zfp592 UTSW 7 81024889 missense possibly damaging 0.83
R0634:Zfp592 UTSW 7 81038071 missense probably damaging 1.00
R0684:Zfp592 UTSW 7 81037875 missense probably benign 0.00
R0750:Zfp592 UTSW 7 81024745 missense probably benign
R1346:Zfp592 UTSW 7 81038064 missense possibly damaging 0.54
R1457:Zfp592 UTSW 7 81024479 missense probably damaging 0.99
R1650:Zfp592 UTSW 7 81038100 missense probably benign 0.04
R1804:Zfp592 UTSW 7 81023695 missense probably damaging 1.00
R1918:Zfp592 UTSW 7 81037420 nonsense probably null
R2114:Zfp592 UTSW 7 81024796 missense probably damaging 1.00
R2144:Zfp592 UTSW 7 81038202 missense probably benign 0.01
R2164:Zfp592 UTSW 7 81041438 missense possibly damaging 0.87
R2246:Zfp592 UTSW 7 81041613 missense possibly damaging 0.91
R3701:Zfp592 UTSW 7 81037411 nonsense probably null
R3809:Zfp592 UTSW 7 81024532 missense probably benign 0.00
R4866:Zfp592 UTSW 7 81041859 missense probably damaging 1.00
R5023:Zfp592 UTSW 7 81024347 missense probably damaging 1.00
R5121:Zfp592 UTSW 7 81023561 missense probably damaging 1.00
R5174:Zfp592 UTSW 7 81038325 missense probably damaging 1.00
R5794:Zfp592 UTSW 7 81025033 missense probably benign 0.00
R5946:Zfp592 UTSW 7 81037897 missense possibly damaging 0.95
R6312:Zfp592 UTSW 7 81023436 missense probably benign 0.05
R6657:Zfp592 UTSW 7 81025486 missense possibly damaging 0.49
R6814:Zfp592 UTSW 7 81023828 missense probably benign 0.02
R6872:Zfp592 UTSW 7 81023828 missense probably benign 0.02
R7056:Zfp592 UTSW 7 81023319 missense probably damaging 1.00
R7295:Zfp592 UTSW 7 81024322 missense probably damaging 1.00
R7351:Zfp592 UTSW 7 81041691 missense probably benign 0.00
R7475:Zfp592 UTSW 7 81023452 missense probably damaging 0.99
R7509:Zfp592 UTSW 7 81038340 missense probably damaging 0.99
R7552:Zfp592 UTSW 7 81023642 missense probably benign 0.01
R7737:Zfp592 UTSW 7 81025193 missense probably damaging 1.00
R7752:Zfp592 UTSW 7 81024721 missense probably benign 0.13
R7901:Zfp592 UTSW 7 81024721 missense probably benign 0.13
R8100:Zfp592 UTSW 7 81024192 missense probably benign 0.05
R8440:Zfp592 UTSW 7 81041523 missense possibly damaging 0.89
R8710:Zfp592 UTSW 7 81023573 missense probably damaging 1.00
R8766:Zfp592 UTSW 7 81024605 missense probably benign 0.00
X0022:Zfp592 UTSW 7 81038187 nonsense probably null
X0028:Zfp592 UTSW 7 81024014 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATAATGGATTCCGGGGCTC -3'
(R):5'- GATCTTTGTGAGGCTCCACCAC -3'

Sequencing Primer
(F):5'- CACCACTGTGGGAAGTTTGATTCTAC -3'
(R):5'- GTGAGGCTCCACCACCTTCTG -3'
Posted On2015-09-24