Incidental Mutation 'R0316:Pdcd11'
ID34236
Institutional Source Beutler Lab
Gene Symbol Pdcd11
Ensembl Gene ENSMUSG00000025047
Gene Nameprogrammed cell death 11
SynonymsALG-4, 1110021I22Rik
MMRRC Submission 038526-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #R0316 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location47090766-47131143 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 47113172 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 932 (V932A)
Ref Sequence ENSEMBL: ENSMUSP00000072008 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072141] [ENSMUST00000140512]
Predicted Effect probably damaging
Transcript: ENSMUST00000072141
AA Change: V932A

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000072008
Gene: ENSMUSG00000025047
AA Change: V932A

DomainStartEndE-ValueType
low complexity region 53 76 N/A INTRINSIC
S1 81 171 1.05e-7 SMART
S1 185 258 2.32e-9 SMART
S1 279 346 1.44e-5 SMART
S1 363 436 8.55e-8 SMART
S1 451 522 3.89e-20 SMART
S1 540 611 1.14e-17 SMART
S1 634 707 2.76e-2 SMART
S1 727 798 2.02e-18 SMART
low complexity region 813 823 N/A INTRINSIC
S1 844 911 6.13e0 SMART
Blast:S1 923 993 8e-39 BLAST
low complexity region 1018 1032 N/A INTRINSIC
S1 1045 1120 1.3e-7 SMART
S1 1158 1233 6.09e-4 SMART
S1 1239 1309 4.14e-6 SMART
S1 1333 1407 1.57e-6 SMART
low complexity region 1433 1473 N/A INTRINSIC
coiled coil region 1557 1588 N/A INTRINSIC
HAT 1591 1622 6.53e2 SMART
HAT 1624 1661 4.12e1 SMART
HAT 1663 1694 3.49e2 SMART
HAT 1696 1728 3.18e-1 SMART
HAT 1730 1764 2.25e2 SMART
HAT 1766 1798 8.52e-2 SMART
HAT 1800 1835 1.33e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140512
SMART Domains Protein: ENSMUSP00000121661
Gene: ENSMUSG00000033033

DomainStartEndE-ValueType
Pfam:Ca_hom_mod 6 258 2.9e-93 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PDCD11 is a NF-kappa-B (NFKB1; 164011)-binding protein that colocalizes with U3 RNA (MIM 180710) in the nucleolus and is required for rRNA maturation and generation of 18S rRNA (Sweet et al., 2003 [PubMed 14624448]; Sweet et al., 2008 [PubMed 17654514]).[supplied by OMIM, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik A T 15: 58,025,369 F276I probably damaging Het
Ado A G 10: 67,548,718 L19P possibly damaging Het
Ago2 T C 15: 73,130,876 H169R probably damaging Het
Asic1 G A 15: 99,671,938 A47T probably benign Het
Atg16l2 A T 7: 101,293,396 I364N probably damaging Het
C130050O18Rik G A 5: 139,414,558 R122Q probably damaging Het
Capn7 T A 14: 31,347,809 C197S probably benign Het
Casp16-ps T C 17: 23,552,092 D113G probably damaging Het
Cdh18 T A 15: 23,366,913 V235D probably damaging Het
Clca4a G T 3: 144,953,764 T777K probably damaging Het
Col17a1 A G 19: 47,685,533 probably null Het
Col5a3 C A 9: 20,775,325 D1335Y unknown Het
Cpxm1 T C 2: 130,393,171 E576G probably damaging Het
Dcbld2 T C 16: 58,433,445 S182P probably damaging Het
Dclk1 C T 3: 55,502,892 S616L probably damaging Het
Dgcr14 G A 16: 17,910,094 P103S probably benign Het
Dll4 C A 2: 119,331,153 D405E probably damaging Het
Dnah1 G A 14: 31,278,151 R2462C probably benign Het
Dnah3 A T 7: 119,965,659 Y2594N possibly damaging Het
Fam110a C A 2: 151,970,086 A255S probably benign Het
Fbn2 G A 18: 58,113,325 R502W probably damaging Het
Fgl2 A G 5: 21,375,523 S288G possibly damaging Het
Gm1527 T C 3: 28,915,774 S342P probably damaging Het
Gm19668 A T 10: 77,798,730 probably benign Het
Gm5901 A T 7: 105,377,315 T97S probably damaging Het
Greb1l A G 18: 10,547,420 Y1546C probably damaging Het
Impg1 A T 9: 80,342,065 S619T probably damaging Het
Itih2 C A 2: 10,105,246 Q565H possibly damaging Het
Kbtbd6 T A 14: 79,453,024 N386K probably benign Het
Lama3 T C 18: 12,519,877 M218T probably benign Het
Lipg T C 18: 74,960,941 S12G probably benign Het
Marf1 C T 16: 14,142,534 A549T probably damaging Het
Mex3d G T 10: 80,381,671 P571T probably damaging Het
Neb A C 2: 52,195,470 Y1538D possibly damaging Het
Nsd1 T C 13: 55,213,771 I184T probably damaging Het
Olfr1143 T C 2: 87,803,181 F264S probably damaging Het
Olfr1451 T A 19: 12,999,402 C139S probably damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Pacs1 T C 19: 5,135,121 silent Het
Pkd2 A G 5: 104,477,166 D276G probably damaging Het
Pkia T A 3: 7,437,439 D25E probably damaging Het
Plxna2 A C 1: 194,644,150 S131R probably damaging Het
Prelid1 T C 13: 55,324,407 V132A possibly damaging Het
Psma3 T C 12: 70,983,389 Y59H probably benign Het
Ptchd3 A C 11: 121,842,090 E602A possibly damaging Het
Ptpro T C 6: 137,376,989 V121A possibly damaging Het
Ptprt A G 2: 161,607,319 L878P probably damaging Het
Pxn G A 5: 115,553,968 G370S probably damaging Het
Rcn2 G T 9: 56,042,169 A40S probably benign Het
Rnf215 A G 11: 4,139,760 N258D probably damaging Het
Rnpc3 T C 3: 113,629,973 T28A probably damaging Het
Rtel1 T A 2: 181,356,002 V1100E possibly damaging Het
Scn3a T A 2: 65,460,829 I1858F probably damaging Het
Slc9c1 G A 16: 45,580,232 R735Q possibly damaging Het
Snapc1 C T 12: 73,975,032 R81C probably damaging Het
Spata13 A G 14: 60,692,339 T449A probably benign Het
Svep1 A G 4: 58,072,737 W2191R probably damaging Het
Thbs1 G A 2: 118,117,574 R405H probably damaging Het
Tnn A G 1: 160,120,567 Y859H possibly damaging Het
Tonsl A G 15: 76,629,300 S1245P possibly damaging Het
Tpcn1 G A 5: 120,539,259 T661M probably damaging Het
Trap1 A G 16: 4,045,560 F533L probably benign Het
Ttc23 T C 7: 67,679,073 probably null Het
Vax2 T C 6: 83,711,444 S50P possibly damaging Het
Vmn1r5 A C 6: 56,985,799 E153A probably benign Het
Vmn2r14 G T 5: 109,218,896 P486Q probably benign Het
Vmn2r96 T A 17: 18,582,565 F246I probably damaging Het
Zc3h10 C A 10: 128,544,755 E244D probably damaging Het
Zdhhc18 T A 4: 133,613,655 K265* probably null Het
Other mutations in Pdcd11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00646:Pdcd11 APN 19 47117328 missense possibly damaging 0.83
IGL00656:Pdcd11 APN 19 47098170 missense probably damaging 1.00
IGL00754:Pdcd11 APN 19 47103782 missense possibly damaging 0.86
IGL00907:Pdcd11 APN 19 47107564 missense probably benign 0.16
IGL00987:Pdcd11 APN 19 47114550 intron probably benign
IGL01346:Pdcd11 APN 19 47109614 missense probably benign 0.03
IGL01529:Pdcd11 APN 19 47109629 missense probably benign 0.01
IGL01670:Pdcd11 APN 19 47106304 missense probably damaging 0.98
IGL01917:Pdcd11 APN 19 47101165 missense possibly damaging 0.92
IGL02096:Pdcd11 APN 19 47106421 missense probably benign 0.10
IGL02300:Pdcd11 APN 19 47126942 missense probably benign
IGL02515:Pdcd11 APN 19 47125077 missense probably damaging 1.00
IGL02886:Pdcd11 APN 19 47113625 missense possibly damaging 0.95
IGL03158:Pdcd11 APN 19 47128061 missense possibly damaging 0.91
R0100:Pdcd11 UTSW 19 47102666 missense probably benign 0.00
R0100:Pdcd11 UTSW 19 47102666 missense probably benign 0.00
R0128:Pdcd11 UTSW 19 47119862 missense probably benign 0.15
R0139:Pdcd11 UTSW 19 47110959 critical splice acceptor site probably null
R0227:Pdcd11 UTSW 19 47113437 intron probably benign
R0480:Pdcd11 UTSW 19 47125037 intron probably benign
R0577:Pdcd11 UTSW 19 47098832 missense probably benign 0.01
R0725:Pdcd11 UTSW 19 47127291 missense probably benign 0.17
R1344:Pdcd11 UTSW 19 47130077 missense probably damaging 1.00
R1418:Pdcd11 UTSW 19 47130077 missense probably damaging 1.00
R1856:Pdcd11 UTSW 19 47098187 missense probably benign 0.00
R2146:Pdcd11 UTSW 19 47104752 missense probably benign 0.00
R2147:Pdcd11 UTSW 19 47104752 missense probably benign 0.00
R2447:Pdcd11 UTSW 19 47114556 missense probably benign 0.01
R2916:Pdcd11 UTSW 19 47113437 intron probably benign
R3177:Pdcd11 UTSW 19 47113264 missense probably damaging 1.00
R3277:Pdcd11 UTSW 19 47113264 missense probably damaging 1.00
R3712:Pdcd11 UTSW 19 47127245 intron probably benign
R4495:Pdcd11 UTSW 19 47111006 missense probably benign
R4697:Pdcd11 UTSW 19 47126347 missense possibly damaging 0.83
R4941:Pdcd11 UTSW 19 47119886 missense probably damaging 1.00
R4953:Pdcd11 UTSW 19 47127965 missense probably benign 0.04
R5048:Pdcd11 UTSW 19 47107115 missense probably benign
R5049:Pdcd11 UTSW 19 47107115 missense probably benign
R5103:Pdcd11 UTSW 19 47124454 missense probably benign 0.00
R5107:Pdcd11 UTSW 19 47106454 missense probably damaging 1.00
R5139:Pdcd11 UTSW 19 47107115 missense probably benign
R5261:Pdcd11 UTSW 19 47113537 missense probably benign
R5302:Pdcd11 UTSW 19 47107644 missense probably damaging 1.00
R5592:Pdcd11 UTSW 19 47102725 missense probably benign
R5769:Pdcd11 UTSW 19 47102637 missense possibly damaging 0.92
R5791:Pdcd11 UTSW 19 47110991 missense possibly damaging 0.65
R5809:Pdcd11 UTSW 19 47093808 missense probably benign 0.01
R5899:Pdcd11 UTSW 19 47104759 missense possibly damaging 0.93
R5901:Pdcd11 UTSW 19 47128332 missense possibly damaging 0.76
R5947:Pdcd11 UTSW 19 47129263 missense probably benign 0.20
R6177:Pdcd11 UTSW 19 47120283 missense probably damaging 1.00
R6489:Pdcd11 UTSW 19 47109752 missense probably damaging 1.00
R6575:Pdcd11 UTSW 19 47109678 missense probably damaging 0.98
R6578:Pdcd11 UTSW 19 47111081 missense probably benign 0.11
R7009:Pdcd11 UTSW 19 47113142 missense probably benign 0.17
R7015:Pdcd11 UTSW 19 47098226 missense probably benign 0.00
R7060:Pdcd11 UTSW 19 47110979 missense probably benign 0.30
R7260:Pdcd11 UTSW 19 47129234 missense possibly damaging 0.62
R7392:Pdcd11 UTSW 19 47127997 missense probably damaging 1.00
R7601:Pdcd11 UTSW 19 47106369 missense not run
R7759:Pdcd11 UTSW 19 47113198 missense possibly damaging 0.88
R7760:Pdcd11 UTSW 19 47113198 missense possibly damaging 0.88
R7785:Pdcd11 UTSW 19 47104686 missense probably benign 0.00
R7793:Pdcd11 UTSW 19 47106432 missense probably benign 0.00
R7810:Pdcd11 UTSW 19 47098220 missense possibly damaging 0.81
R7863:Pdcd11 UTSW 19 47096964 missense probably damaging 1.00
R7950:Pdcd11 UTSW 19 47113437 intron probably benign
R8062:Pdcd11 UTSW 19 47130713 missense possibly damaging 0.50
R8184:Pdcd11 UTSW 19 47113352 nonsense probably null
R8278:Pdcd11 UTSW 19 47106297 missense probably damaging 1.00
R8404:Pdcd11 UTSW 19 47104792 missense probably damaging 0.98
R8508:Pdcd11 UTSW 19 47119806 missense probably damaging 1.00
RF010:Pdcd11 UTSW 19 47113451 frame shift probably null
RF027:Pdcd11 UTSW 19 47113449 frame shift probably null
RF039:Pdcd11 UTSW 19 47113455 frame shift probably null
RF061:Pdcd11 UTSW 19 47113445 frame shift probably null
X0065:Pdcd11 UTSW 19 47096896 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCCCAATTTCCAGGCAGCGTG -3'
(R):5'- TGGTCTTGAGGGTAAGGCAGACAC -3'

Sequencing Primer
(F):5'- tgggaggcagaggcagg -3'
(R):5'- GACACCCTGCCCCACAC -3'
Posted On2013-05-09