Mutagenetix > Incidental Mutation

Incidental Mutation 'R4574:Mpp7'

342363

Institutional Source

Beutler Lab

Gene Symbol

Mpp7

Ensembl Gene

ENSMUSG00000057440

Gene Name

membrane protein, palmitoylated 7 (MAGUK p55 subfamily member 7)

Synonyms

2810038M04Rik, LOC381166, 1110068J02Rik, 5430426E14Rik

MMRRC Submission

041797-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.116) question?

Stock #

R4574 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

7347962-7626863 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 7353228 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Serine at position 493 (R493S)

Ref Sequence

ENSEMBL: ENSMUSP00000111535 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000115869]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000115869
AA Change: R493S

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000111535
Gene: ENSMUSG00000057440
AA Change: R493S

Domain	Start	End	E-Value	Type
L27	10	68	7.05e-14	SMART
L27	72	125	3.72e-13	SMART
PDZ	147	220	3.8e-15	SMART
SH3	231	297	1.4e-11	SMART
low complexity region	317	328	N/A	INTRINSIC
GuKc	367	563	4.01e-65	SMART

Meta Mutation Damage Score

0.1014

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

97% (63/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the p55 Stardust family of membrane-associated guanylate kinase (MAGUK) proteins, which function in the establishment of epithelial cell polarity. This family member forms a complex with the polarity protein DLG1 (discs, large homolog 1) and facilitates epithelial cell polarity and tight junction formation. Polymorphisms in this gene are associated with variations in site-specific bone mineral density (BMD). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700021F05Rik	T	A	10: 43,533,010	S46C	probably damaging	Het
Adam1b	A	C	5: 121,500,793	S730A	probably benign	Het
Adamts9	G	A	6: 92,879,959	R319*	probably null	Het
Anapc1	G	T	2: 128,627,195	S1575R	probably damaging	Het
Appbp2	A	T	11: 85,209,938		probably null	Het
Bcas2	C	T	3: 103,174,350	P90S	probably benign	Het
Carmil3	GGACGA	GGA	14: 55,499,476		probably benign	Het
Cd101	T	C	3: 101,013,153	N477D	probably benign	Het
Cdk12	A	G	11: 98,220,988		probably benign	Het
Clcn4	T	C	7: 7,287,805	E634G	probably benign	Het
Cltb	C	T	13: 54,598,761	R64H	probably damaging	Het
Cpt1b	G	T	15: 89,424,044		probably null	Het
Ctf2	T	G	7: 127,719,384	T148P	possibly damaging	Het
Ddx23	G	A	15: 98,647,624	T601I	probably damaging	Het
Dlx6	G	T	6: 6,865,305		probably benign	Het
Dmrtb1	A	T	4: 107,677,068	N183K	possibly damaging	Het
Dnah11	A	G	12: 118,012,255		probably null	Het
Dnah5	C	T	15: 28,367,763	P2765S	probably benign	Het
Dnah6	T	A	6: 73,086,181	N2698I	probably damaging	Het
Fpr-rs6	T	A	17: 20,183,097	M1L	probably damaging	Het
Gm4841	T	C	18: 60,269,926	N365S	probably benign	Het
Gsdmc2	C	T	15: 63,828,023		probably null	Het
Irx5	G	A	8: 92,358,262	V27I	probably damaging	Het
Kmt2e	T	A	5: 23,492,407	V101D	possibly damaging	Het
Maip1	A	C	1: 57,413,245	K219Q	possibly damaging	Het
Ms4a14	T	C	19: 11,303,971	T408A	probably benign	Het
Mthfr	A	G	4: 148,043,541	N117S	possibly damaging	Het
Myo5c	A	G	9: 75,269,611	I613V	probably benign	Het
Neurl1b	A	G	17: 26,431,886	Q44R	probably benign	Het
Nup54	T	A	5: 92,425,782	N187I	probably benign	Het
Ofcc1	G	A	13: 40,015,388	T841I	probably damaging	Het
Olfr992	C	A	2: 85,400,026	C169F	probably damaging	Het
Pate2	C	A	9: 35,685,673		probably benign	Het
Pccb	T	C	9: 100,985,199	S445G	probably damaging	Het
Pex3	G	A	10: 13,535,571	Q188*	probably null	Het
Pikfyve	T	A	1: 65,192,192	W74R	probably damaging	Het
Plcl2	T	C	17: 50,607,846	S628P	probably damaging	Het
Pnldc1	T	C	17: 12,892,782	H346R	probably benign	Het
Pom121l2	T	A	13: 21,984,402	C948S	probably benign	Het
Pspc1	A	T	14: 56,761,947	M284K	possibly damaging	Het
Ralgapa2	A	G	2: 146,435,999	L414S	probably damaging	Het
Rgs13	T	A	1: 144,140,845	K53N	probably damaging	Het
Rorc	T	C	3: 94,388,984	S163P	probably benign	Het
Rpl3l	A	C	17: 24,734,010	T315P	possibly damaging	Het
Rsph3b	A	G	17: 6,905,039	V487A	probably benign	Het
Rusc2	A	G	4: 43,416,080	E462G	probably damaging	Het
Sez6l	T	C	5: 112,428,478	T838A	probably damaging	Het
Slc22a14	A	G	9: 119,179,495	Y236H	probably damaging	Het
Sspo	G	A	6: 48,465,523	R1984H	probably damaging	Het
Steap3	G	T	1: 120,241,456	D370E	probably benign	Het
Sumf1	A	G	6: 108,108,432		probably benign	Het
Telo2	T	C	17: 25,101,673	E754G	probably damaging	Het
Tjp1	A	G	7: 65,322,605	F604L	probably damaging	Het
Trpm7	A	T	2: 126,797,211	D1734E	probably benign	Het
Tsfm	A	C	10: 127,028,373	Y158D	probably damaging	Het
Ubtf	T	C	11: 102,306,765		probably benign	Het
Upk3a	G	T	15: 85,020,551	V167F	possibly damaging	Het
Vmn2r19	C	T	6: 123,315,980	S327L	probably benign	Het
Vps13c	T	A	9: 67,951,683	I2805N	probably damaging	Het
Zfp592	A	G	7: 81,023,786	D166G	possibly damaging	Het

Other mutations in Mpp7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00938:Mpp7	APN	18	7353297	missense	probably benign	0.00
IGL01575:Mpp7	APN	18	7403365	splice site	probably benign
IGL02973:Mpp7	APN	18	7403297	missense	probably damaging	1.00
IGL02985:Mpp7	APN	18	7461637	critical splice donor site	probably null
IGL03224:Mpp7	APN	18	7403269	missense	probably benign	0.28
IGL03248:Mpp7	APN	18	7403269	missense	probably benign	0.28
R0040:Mpp7	UTSW	18	7403180	splice site	probably benign
R0089:Mpp7	UTSW	18	7439555	splice site	probably benign
R1413:Mpp7	UTSW	18	7350977	missense	probably damaging	1.00
R1634:Mpp7	UTSW	18	7350984	missense	possibly damaging	0.63
R1859:Mpp7	UTSW	18	7350967	makesense	probably null
R2379:Mpp7	UTSW	18	7403345	nonsense	probably null
R2869:Mpp7	UTSW	18	7461678	missense	possibly damaging	0.76
R2869:Mpp7	UTSW	18	7461678	missense	possibly damaging	0.76
R2871:Mpp7	UTSW	18	7461678	missense	possibly damaging	0.76
R2871:Mpp7	UTSW	18	7461678	missense	possibly damaging	0.76
R3008:Mpp7	UTSW	18	7461678	missense	possibly damaging	0.76
R3009:Mpp7	UTSW	18	7461678	missense	possibly damaging	0.76
R3010:Mpp7	UTSW	18	7461678	missense	possibly damaging	0.76
R3782:Mpp7	UTSW	18	7351085	missense	probably damaging	0.99
R3980:Mpp7	UTSW	18	7444062	missense	probably benign	0.23
R4772:Mpp7	UTSW	18	7379983	splice site	probably null
R5066:Mpp7	UTSW	18	7513002	missense	possibly damaging	0.95
R5437:Mpp7	UTSW	18	7458930	critical splice donor site	probably null
R5451:Mpp7	UTSW	18	7442855	missense	probably null	0.95
R5578:Mpp7	UTSW	18	7355101	missense	probably benign
R5651:Mpp7	UTSW	18	7355016	critical splice donor site	probably null
R5787:Mpp7	UTSW	18	7461682	missense	probably benign
R6979:Mpp7	UTSW	18	7355049	missense	possibly damaging	0.64
R6984:Mpp7	UTSW	18	7441623	missense	probably damaging	1.00
R7448:Mpp7	UTSW	18	7351079	missense	probably damaging	0.98
R7517:Mpp7	UTSW	18	7440183	nonsense	probably null
R8278:Mpp7	UTSW	18	7444025	missense	probably benign
R8373:Mpp7	UTSW	18	7444096	missense	probably damaging	1.00
R8676:Mpp7	UTSW	18	7440430	critical splice donor site	probably null
R9206:Mpp7	UTSW	18	7403327	missense	probably benign	0.12
R9208:Mpp7	UTSW	18	7403327	missense	probably benign	0.12
R9439:Mpp7	UTSW	18	7461692	nonsense	probably null
R9790:Mpp7	UTSW	18	7355049	missense	probably benign	0.07
R9791:Mpp7	UTSW	18	7355049	missense	probably benign	0.07
X0028:Mpp7	UTSW	18	7403273	missense	probably benign	0.04
Z1177:Mpp7	UTSW	18	7355062	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CAGAGTTCGGGATCACAACTTC -3'
(R):5'- TGATGAGAATGCCACGCTC -3'

Sequencing Primer
(F):5'- GGGATCACAACTTCATCATTAACAG -3'
(R):5'- GATGAGAATGCCACGCTCATTGTC -3'

Posted On

2015-09-24