Incidental Mutation 'R4575:Rpn2'
ID342375
Institutional Source Beutler Lab
Gene Symbol Rpn2
Ensembl Gene ENSMUSG00000027642
Gene Nameribophorin II
SynonymsRpn-2, 1300012C06Rik
MMRRC Submission 041798-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4575 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location157279017-157326319 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 157295324 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 209 (A209E)
Ref Sequence ENSEMBL: ENSMUSP00000112081 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029171] [ENSMUST00000116380]
Predicted Effect probably damaging
Transcript: ENSMUST00000029171
AA Change: A177E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029171
Gene: ENSMUSG00000027642
AA Change: A177E

DomainStartEndE-ValueType
Pfam:Ribophorin_II 2 71 1.5e-15 PFAM
Pfam:Ribophorin_II 68 596 3.5e-247 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000116380
AA Change: A209E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112081
Gene: ENSMUSG00000027642
AA Change: A209E

DomainStartEndE-ValueType
Pfam:Ribophorin_II 9 627 1.8e-223 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125311
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126248
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127252
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150349
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156007
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type I integral membrane protein found only in the rough endoplasmic reticulum. The encoded protein is part of an N-oligosaccharyl transferase complex that links high mannose oligosaccharides to asparagine residues found in the Asn-X-Ser/Thr consensus motif of nascent polypeptide chains. This protein is similar in sequence to the yeast oligosaccharyl transferase subunit SWP1. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057M21Rik C T 7: 131,362,596 A26T probably benign Het
4930408O17Rik C A 12: 104,871,268 noncoding transcript Het
Adgrf3 T A 5: 30,202,257 M224L probably benign Het
Ago3 T C 4: 126,346,682 H129R probably benign Het
Asb10 C T 5: 24,540,054 R99H probably damaging Het
Auts2 C T 5: 132,258,934 G70E probably benign Het
Ccdc96 T C 5: 36,486,075 V475A possibly damaging Het
Clec4b2 T A 6: 123,173,680 L16Q probably damaging Het
Cyp2c68 T A 19: 39,734,361 I248L probably benign Het
Cyp2d22 G T 15: 82,371,932 A167E possibly damaging Het
Doxl2 C T 6: 48,977,568 Q547* probably null Het
Dpysl3 T C 18: 43,342,247 K382R probably damaging Het
Dscam A G 16: 96,825,623 I362T possibly damaging Het
Edil3 T C 13: 89,319,731 Y452H probably damaging Het
Elfn1 T C 5: 139,972,053 S271P probably benign Het
Ep300 T C 15: 81,649,009 S1756P unknown Het
Ep300 T A 15: 81,611,410 probably benign Het
Fam166a T C 2: 25,220,288 S71P probably benign Het
Fgd4 T C 16: 16,437,032 Q507R probably damaging Het
Frem3 A G 8: 80,616,075 T1666A probably benign Het
Frmd4a C A 2: 4,603,679 A786E possibly damaging Het
Gabrr1 C T 4: 33,158,175 T266I possibly damaging Het
Gm11563 G A 11: 99,658,449 P160S unknown Het
Gm12166 T C 11: 46,051,852 D148G probably damaging Het
Gm12790 T C 4: 101,968,127 D30G probably benign Het
Haus8 A G 8: 71,263,092 V34A probably damaging Het
Hgf T C 5: 16,572,601 Y199H probably benign Het
Ide G A 19: 37,272,205 P916L unknown Het
Igsf10 G T 3: 59,330,100 H887N probably benign Het
Iigp1 A T 18: 60,390,146 H112L probably benign Het
Impg2 A G 16: 56,261,732 E1009G probably damaging Het
Khdc1a A C 1: 21,350,429 D91A probably damaging Het
Klk12 A G 7: 43,773,243 D198G probably damaging Het
Kntc1 T G 5: 123,765,955 L345R probably damaging Het
Kprp T C 3: 92,823,964 N593S probably benign Het
Krt2 T G 15: 101,814,486 D359A probably damaging Het
Krt35 A T 11: 100,095,899 N96K probably benign Het
Lnx1 T C 5: 74,685,543 D82G probably damaging Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Nfib A T 4: 82,296,811 S518R probably damaging Het
Nol6 T C 4: 41,120,299 I473V probably benign Het
Obscn T C 11: 59,122,772 D1108G probably damaging Het
Olfr553 A T 7: 102,614,769 C73* probably null Het
Olfr834 C A 9: 18,988,705 S239* probably null Het
Otop1 T C 5: 38,299,721 Y275H probably damaging Het
Ppp1r14c G T 10: 3,366,912 K82N probably damaging Het
Prr14l T C 5: 32,793,644 E1935G probably damaging Het
Ptprd C T 4: 76,243,786 V78I possibly damaging Het
Rfc4 T A 16: 23,114,429 probably benign Het
Sf1 T C 19: 6,375,913 probably benign Het
Skint5 T A 4: 113,667,193 S864C unknown Het
Slc2a10 C G 2: 165,516,321 N455K probably damaging Het
Snrnp200 T A 2: 127,235,066 I1673N probably benign Het
Sri G T 5: 8,063,693 G152W probably damaging Het
Srpr T C 9: 35,214,608 I394T possibly damaging Het
Svop C T 5: 114,065,682 V13M probably damaging Het
Traf3ip2 A G 10: 39,634,654 N308D probably damaging Het
Uhrf1bp1 T C 17: 27,887,503 V1001A probably benign Het
Vmn2r125 T A 4: 156,349,977 D19E probably null Het
Vmn2r16 A T 5: 109,363,799 Y624F possibly damaging Het
Other mutations in Rpn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00547:Rpn2 APN 2 157314913 missense probably damaging 1.00
IGL01894:Rpn2 APN 2 157294173 missense probably benign 0.45
IGL02104:Rpn2 APN 2 157321827 missense probably damaging 1.00
IGL02368:Rpn2 APN 2 157302408 missense probably benign
IGL02819:Rpn2 APN 2 157316210 critical splice donor site probably null
R0932:Rpn2 UTSW 2 157283771 missense possibly damaging 0.66
R1666:Rpn2 UTSW 2 157294155 missense possibly damaging 0.93
R1668:Rpn2 UTSW 2 157294155 missense possibly damaging 0.93
R1713:Rpn2 UTSW 2 157314968 missense probably damaging 0.99
R2276:Rpn2 UTSW 2 157310288 missense possibly damaging 0.64
R2279:Rpn2 UTSW 2 157310288 missense possibly damaging 0.64
R3409:Rpn2 UTSW 2 157290652 missense possibly damaging 0.91
R3411:Rpn2 UTSW 2 157290652 missense possibly damaging 0.91
R3777:Rpn2 UTSW 2 157299557 missense probably damaging 0.99
R4004:Rpn2 UTSW 2 157318008 missense probably damaging 1.00
R4613:Rpn2 UTSW 2 157302425 missense possibly damaging 0.87
R4856:Rpn2 UTSW 2 157318044 critical splice donor site probably null
R4886:Rpn2 UTSW 2 157318044 critical splice donor site probably null
R5491:Rpn2 UTSW 2 157297383 missense probably damaging 0.99
R5526:Rpn2 UTSW 2 157323267 missense probably damaging 1.00
R5633:Rpn2 UTSW 2 157283596 missense possibly damaging 0.81
R5718:Rpn2 UTSW 2 157321827 missense probably damaging 1.00
R5772:Rpn2 UTSW 2 157295345 missense probably damaging 1.00
R6101:Rpn2 UTSW 2 157310188 splice site probably null
R6618:Rpn2 UTSW 2 157321861 missense probably benign
R6698:Rpn2 UTSW 2 157297410 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- CCGTTAAGAAAGGCCAGCTG -3'
(R):5'- TAGGATAGGCATCAATCAATCCCC -3'

Sequencing Primer
(F):5'- AGCTGTCTGGGGTCACG -3'
(R):5'- AGTCTTTAAACCTAACTAAATCCTGC -3'
Posted On2015-09-24