Incidental Mutation 'R4575:Slc2a10'
ID342376
Institutional Source Beutler Lab
Gene Symbol Slc2a10
Ensembl Gene ENSMUSG00000027661
Gene Namesolute carrier family 2 (facilitated glucose transporter), member 10
SynonymsGlut10
MMRRC Submission 041798-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R4575 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location165503787-165519917 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 165516321 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 455 (N455K)
Ref Sequence ENSEMBL: ENSMUSP00000029196 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029196]
Predicted Effect probably damaging
Transcript: ENSMUST00000029196
AA Change: N455K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029196
Gene: ENSMUSG00000027661
AA Change: N455K

DomainStartEndE-ValueType
Pfam:Sugar_tr 10 333 1.7e-51 PFAM
Pfam:MFS_1 14 337 1.1e-28 PFAM
Pfam:Sugar_tr 387 508 3.9e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148463
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a class III facilitative glucose transporter. Mutations in the related gene in human are associated with arterial tortuosity syndrome. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mice carrying ENU-induced mutations in this gene display thickening and aberrant vessel wall shape of large and medium size arteries, with significantly increased elastic fiber number and size. Cerebral arteries appear normal with no evidence of tortuosity, stenosis/dilatation or aneurysm. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057M21Rik C T 7: 131,362,596 A26T probably benign Het
4930408O17Rik C A 12: 104,871,268 noncoding transcript Het
Adgrf3 T A 5: 30,202,257 M224L probably benign Het
Ago3 T C 4: 126,346,682 H129R probably benign Het
Asb10 C T 5: 24,540,054 R99H probably damaging Het
Auts2 C T 5: 132,258,934 G70E probably benign Het
Ccdc96 T C 5: 36,486,075 V475A possibly damaging Het
Clec4b2 T A 6: 123,173,680 L16Q probably damaging Het
Cyp2c68 T A 19: 39,734,361 I248L probably benign Het
Cyp2d22 G T 15: 82,371,932 A167E possibly damaging Het
Doxl2 C T 6: 48,977,568 Q547* probably null Het
Dpysl3 T C 18: 43,342,247 K382R probably damaging Het
Dscam A G 16: 96,825,623 I362T possibly damaging Het
Edil3 T C 13: 89,319,731 Y452H probably damaging Het
Elfn1 T C 5: 139,972,053 S271P probably benign Het
Ep300 T C 15: 81,649,009 S1756P unknown Het
Ep300 T A 15: 81,611,410 probably benign Het
Fam166a T C 2: 25,220,288 S71P probably benign Het
Fgd4 T C 16: 16,437,032 Q507R probably damaging Het
Frem3 A G 8: 80,616,075 T1666A probably benign Het
Frmd4a C A 2: 4,603,679 A786E possibly damaging Het
Gabrr1 C T 4: 33,158,175 T266I possibly damaging Het
Gm11563 G A 11: 99,658,449 P160S unknown Het
Gm12166 T C 11: 46,051,852 D148G probably damaging Het
Gm12790 T C 4: 101,968,127 D30G probably benign Het
Haus8 A G 8: 71,263,092 V34A probably damaging Het
Hgf T C 5: 16,572,601 Y199H probably benign Het
Ide G A 19: 37,272,205 P916L unknown Het
Igsf10 G T 3: 59,330,100 H887N probably benign Het
Iigp1 A T 18: 60,390,146 H112L probably benign Het
Impg2 A G 16: 56,261,732 E1009G probably damaging Het
Khdc1a A C 1: 21,350,429 D91A probably damaging Het
Klk12 A G 7: 43,773,243 D198G probably damaging Het
Kntc1 T G 5: 123,765,955 L345R probably damaging Het
Kprp T C 3: 92,823,964 N593S probably benign Het
Krt2 T G 15: 101,814,486 D359A probably damaging Het
Krt35 A T 11: 100,095,899 N96K probably benign Het
Lnx1 T C 5: 74,685,543 D82G probably damaging Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Nfib A T 4: 82,296,811 S518R probably damaging Het
Nol6 T C 4: 41,120,299 I473V probably benign Het
Obscn T C 11: 59,122,772 D1108G probably damaging Het
Olfr553 A T 7: 102,614,769 C73* probably null Het
Olfr834 C A 9: 18,988,705 S239* probably null Het
Otop1 T C 5: 38,299,721 Y275H probably damaging Het
Ppp1r14c G T 10: 3,366,912 K82N probably damaging Het
Prr14l T C 5: 32,793,644 E1935G probably damaging Het
Ptprd C T 4: 76,243,786 V78I possibly damaging Het
Rfc4 T A 16: 23,114,429 probably benign Het
Rpn2 C A 2: 157,295,324 A209E probably damaging Het
Sf1 T C 19: 6,375,913 probably benign Het
Skint5 T A 4: 113,667,193 S864C unknown Het
Snrnp200 T A 2: 127,235,066 I1673N probably benign Het
Sri G T 5: 8,063,693 G152W probably damaging Het
Srpr T C 9: 35,214,608 I394T possibly damaging Het
Svop C T 5: 114,065,682 V13M probably damaging Het
Traf3ip2 A G 10: 39,634,654 N308D probably damaging Het
Uhrf1bp1 T C 17: 27,887,503 V1001A probably benign Het
Vmn2r125 T A 4: 156,349,977 D19E probably null Het
Vmn2r16 A T 5: 109,363,799 Y624F possibly damaging Het
Other mutations in Slc2a10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Slc2a10 APN 2 165514780 missense probably damaging 1.00
IGL01465:Slc2a10 APN 2 165517677 missense possibly damaging 0.88
IGL02565:Slc2a10 APN 2 165515080 missense probably damaging 0.99
IGL02902:Slc2a10 APN 2 165518222 missense probably benign 0.08
PIT4362001:Slc2a10 UTSW 2 165516293 missense probably damaging 1.00
R1453:Slc2a10 UTSW 2 165517650 missense probably damaging 1.00
R1677:Slc2a10 UTSW 2 165515441 missense probably benign 0.04
R1850:Slc2a10 UTSW 2 165515213 missense probably benign 0.00
R1920:Slc2a10 UTSW 2 165514630 missense probably damaging 1.00
R2269:Slc2a10 UTSW 2 165514781 nonsense probably null
R3921:Slc2a10 UTSW 2 165515601 missense probably benign 0.00
R4407:Slc2a10 UTSW 2 165514764 missense probably damaging 1.00
R4864:Slc2a10 UTSW 2 165514621 missense probably benign 0.13
R4923:Slc2a10 UTSW 2 165514756 missense possibly damaging 0.62
R4935:Slc2a10 UTSW 2 165517658 missense probably benign 0.05
R4954:Slc2a10 UTSW 2 165514755 missense probably damaging 0.99
R5681:Slc2a10 UTSW 2 165514740 missense probably benign 0.00
R5782:Slc2a10 UTSW 2 165514838 nonsense probably null
R6116:Slc2a10 UTSW 2 165517703 missense probably damaging 1.00
R6713:Slc2a10 UTSW 2 165515208 missense probably damaging 1.00
R7179:Slc2a10 UTSW 2 165515349 missense probably damaging 1.00
R7237:Slc2a10 UTSW 2 165515277 missense probably benign
R7568:Slc2a10 UTSW 2 165514882 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACACAGGTCTCAGTTAACGAGG -3'
(R):5'- CCCAGTGGCTTTGTTTGAAG -3'

Sequencing Primer
(F):5'- CTCAGTTAACGAGGGTGGG -3'
(R):5'- CCGCTCATTTAGGTGACCTAAG -3'
Posted On2015-09-24