Incidental Mutation 'R4575:Kprp'
ID342379
Institutional Source Beutler Lab
Gene Symbol Kprp
Ensembl Gene ENSMUSG00000059832
Gene Namekeratinocyte expressed, proline-rich
Synonyms1110001M24Rik
MMRRC Submission 041798-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.197) question?
Stock #R4575 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location92823074-92827247 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 92823964 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 593 (N593S)
Ref Sequence ENSEMBL: ENSMUSP00000072200 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072363]
Predicted Effect probably benign
Transcript: ENSMUST00000072363
AA Change: N593S

PolyPhen 2 Score 0.107 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000072200
Gene: ENSMUSG00000059832
AA Change: N593S

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
low complexity region 177 199 N/A INTRINSIC
low complexity region 292 302 N/A INTRINSIC
low complexity region 325 338 N/A INTRINSIC
low complexity region 380 397 N/A INTRINSIC
low complexity region 446 502 N/A INTRINSIC
low complexity region 515 534 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a proline-rich skin protein possibly involved in keratinocyte differentiation. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057M21Rik C T 7: 131,362,596 A26T probably benign Het
4930408O17Rik C A 12: 104,871,268 noncoding transcript Het
Adgrf3 T A 5: 30,202,257 M224L probably benign Het
Ago3 T C 4: 126,346,682 H129R probably benign Het
Asb10 C T 5: 24,540,054 R99H probably damaging Het
Auts2 C T 5: 132,258,934 G70E probably benign Het
Ccdc96 T C 5: 36,486,075 V475A possibly damaging Het
Clec4b2 T A 6: 123,173,680 L16Q probably damaging Het
Cyp2c68 T A 19: 39,734,361 I248L probably benign Het
Cyp2d22 G T 15: 82,371,932 A167E possibly damaging Het
Doxl2 C T 6: 48,977,568 Q547* probably null Het
Dpysl3 T C 18: 43,342,247 K382R probably damaging Het
Dscam A G 16: 96,825,623 I362T possibly damaging Het
Edil3 T C 13: 89,319,731 Y452H probably damaging Het
Elfn1 T C 5: 139,972,053 S271P probably benign Het
Ep300 T C 15: 81,649,009 S1756P unknown Het
Ep300 T A 15: 81,611,410 probably benign Het
Fam166a T C 2: 25,220,288 S71P probably benign Het
Fgd4 T C 16: 16,437,032 Q507R probably damaging Het
Frem3 A G 8: 80,616,075 T1666A probably benign Het
Frmd4a C A 2: 4,603,679 A786E possibly damaging Het
Gabrr1 C T 4: 33,158,175 T266I possibly damaging Het
Gm11563 G A 11: 99,658,449 P160S unknown Het
Gm12166 T C 11: 46,051,852 D148G probably damaging Het
Gm12790 T C 4: 101,968,127 D30G probably benign Het
Haus8 A G 8: 71,263,092 V34A probably damaging Het
Hgf T C 5: 16,572,601 Y199H probably benign Het
Ide G A 19: 37,272,205 P916L unknown Het
Igsf10 G T 3: 59,330,100 H887N probably benign Het
Iigp1 A T 18: 60,390,146 H112L probably benign Het
Impg2 A G 16: 56,261,732 E1009G probably damaging Het
Khdc1a A C 1: 21,350,429 D91A probably damaging Het
Klk12 A G 7: 43,773,243 D198G probably damaging Het
Kntc1 T G 5: 123,765,955 L345R probably damaging Het
Krt2 T G 15: 101,814,486 D359A probably damaging Het
Krt35 A T 11: 100,095,899 N96K probably benign Het
Lnx1 T C 5: 74,685,543 D82G probably damaging Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Nfib A T 4: 82,296,811 S518R probably damaging Het
Nol6 T C 4: 41,120,299 I473V probably benign Het
Obscn T C 11: 59,122,772 D1108G probably damaging Het
Olfr553 A T 7: 102,614,769 C73* probably null Het
Olfr834 C A 9: 18,988,705 S239* probably null Het
Otop1 T C 5: 38,299,721 Y275H probably damaging Het
Ppp1r14c G T 10: 3,366,912 K82N probably damaging Het
Prr14l T C 5: 32,793,644 E1935G probably damaging Het
Ptprd C T 4: 76,243,786 V78I possibly damaging Het
Rfc4 T A 16: 23,114,429 probably benign Het
Rpn2 C A 2: 157,295,324 A209E probably damaging Het
Sf1 T C 19: 6,375,913 probably benign Het
Skint5 T A 4: 113,667,193 S864C unknown Het
Slc2a10 C G 2: 165,516,321 N455K probably damaging Het
Snrnp200 T A 2: 127,235,066 I1673N probably benign Het
Sri G T 5: 8,063,693 G152W probably damaging Het
Srpr T C 9: 35,214,608 I394T possibly damaging Het
Svop C T 5: 114,065,682 V13M probably damaging Het
Traf3ip2 A G 10: 39,634,654 N308D probably damaging Het
Uhrf1bp1 T C 17: 27,887,503 V1001A probably benign Het
Vmn2r125 T A 4: 156,349,977 D19E probably null Het
Vmn2r16 A T 5: 109,363,799 Y624F possibly damaging Het
Other mutations in Kprp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00727:Kprp APN 3 92824427 missense unknown
IGL01566:Kprp APN 3 92823964 missense probably benign 0.11
R0062:Kprp UTSW 3 92824682 missense probably damaging 1.00
R0062:Kprp UTSW 3 92824682 missense probably damaging 1.00
R0244:Kprp UTSW 3 92825411 missense probably benign 0.06
R0364:Kprp UTSW 3 92824335 nonsense probably null
R0414:Kprp UTSW 3 92825713 missense probably damaging 1.00
R0511:Kprp UTSW 3 92824723 missense probably damaging 1.00
R0555:Kprp UTSW 3 92824357 missense unknown
R0800:Kprp UTSW 3 92825035 missense unknown
R1356:Kprp UTSW 3 92825602 missense probably damaging 1.00
R1550:Kprp UTSW 3 92824726 missense probably damaging 0.96
R1571:Kprp UTSW 3 92825382 nonsense probably null
R1618:Kprp UTSW 3 92825476 missense probably damaging 0.99
R2424:Kprp UTSW 3 92825605 missense probably damaging 1.00
R2680:Kprp UTSW 3 92824463 missense unknown
R3605:Kprp UTSW 3 92824281 missense unknown
R3606:Kprp UTSW 3 92824281 missense unknown
R3607:Kprp UTSW 3 92824281 missense unknown
R3755:Kprp UTSW 3 92825039 missense unknown
R4116:Kprp UTSW 3 92823968 missense probably damaging 1.00
R4204:Kprp UTSW 3 92824739 missense probably damaging 0.99
R4320:Kprp UTSW 3 92824856 missense probably damaging 1.00
R4321:Kprp UTSW 3 92824856 missense probably damaging 1.00
R4323:Kprp UTSW 3 92824856 missense probably damaging 1.00
R4864:Kprp UTSW 3 92824522 missense unknown
R5133:Kprp UTSW 3 92824522 missense unknown
R5583:Kprp UTSW 3 92824336 missense unknown
R5902:Kprp UTSW 3 92824528 missense unknown
R5990:Kprp UTSW 3 92824774 missense probably damaging 1.00
R6198:Kprp UTSW 3 92824687 missense probably damaging 1.00
R6633:Kprp UTSW 3 92825293 missense probably damaging 1.00
R7025:Kprp UTSW 3 92825197 missense probably benign 0.03
R7269:Kprp UTSW 3 92823871 missense probably damaging 0.96
R7951:Kprp UTSW 3 92824330 missense unknown
R8298:Kprp UTSW 3 92825300 missense probably damaging 1.00
Z1088:Kprp UTSW 3 92825057 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TAAGCCCCACAGTTCATGC -3'
(R):5'- ATGCTCAGCTCCTCAACCAG -3'

Sequencing Primer
(F):5'- AGTTCATGCCACCACAGGTATTTC -3'
(R):5'- CAGTTCACTGTGAGAATCCAGGTC -3'
Posted On2015-09-24