Mutagenetix > Incidental Mutation

Incidental Mutation 'R4575:Auts2'

342398

Institutional Source

Beutler Lab

Gene Symbol

Auts2

Ensembl Gene

ENSMUSG00000029673

Gene Name

autism susceptibility candidate 2

Synonyms

D830032G16Rik, 2700063G02Rik, A730011F23Rik

MMRRC Submission

041798-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4575 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

131437333-132543344 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 132258934 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Glutamic Acid at position 70 (G70E)

Ref Sequence

ENSEMBL: ENSMUSP00000125706 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000160135]

AlphaFold

A0A087WPF7

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000071591

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000100564

Predicted Effect

probably benign
Transcript: ENSMUST00000160135
AA Change: G70E

PolyPhen 2 Score 0.172 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000125706
Gene: ENSMUSG00000029673
AA Change: G70E

Domain	Start	End	E-Value	Type
low complexity region	32	49	N/A	INTRINSIC
low complexity region	98	113	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161108

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161226

SMART Domains

Protein: ENSMUSP00000124900
Gene: ENSMUSG00000029673

Domain	Start	End	E-Value	Type
low complexity region	11	45	N/A	INTRINSIC
low complexity region	62	82	N/A	INTRINSIC
low complexity region	133	150	N/A	INTRINSIC
low complexity region	199	214	N/A	INTRINSIC
low complexity region	297	315	N/A	INTRINSIC
low complexity region	330	355	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182575

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182974

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene has been implicated in neurodevelopment and as a candidate gene for numerous neurological disorders, including autism spectrum disorders, intellectual disability, and developmental delay. Mutations in this gene have also been associated with non-neurological disorders, such as acute lymphoblastic leukemia, aging of the skin, early-onset androgenetic alopecia, and certain cancers. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2014]
PHENOTYPE: Mice homozygous for a brain-specific knockout are smaller than controls, and exhibit behavioral defects such as less vocalizations, impairments in righting response and geotaxis, and decreased food intake. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310057M21Rik	C	T	7: 131,362,596	A26T	probably benign	Het
4930408O17Rik	C	A	12: 104,871,268		noncoding transcript	Het
Adgrf3	T	A	5: 30,202,257	M224L	probably benign	Het
Ago3	T	C	4: 126,346,682	H129R	probably benign	Het
Asb10	C	T	5: 24,540,054	R99H	probably damaging	Het
Ccdc96	T	C	5: 36,486,075	V475A	possibly damaging	Het
Clec4b2	T	A	6: 123,173,680	L16Q	probably damaging	Het
Cyp2c68	T	A	19: 39,734,361	I248L	probably benign	Het
Cyp2d22	G	T	15: 82,371,932	A167E	possibly damaging	Het
Doxl2	C	T	6: 48,977,568	Q547*	probably null	Het
Dpysl3	T	C	18: 43,342,247	K382R	probably damaging	Het
Dscam	A	G	16: 96,825,623	I362T	possibly damaging	Het
Edil3	T	C	13: 89,319,731	Y452H	probably damaging	Het
Elfn1	T	C	5: 139,972,053	S271P	probably benign	Het
Ep300	T	C	15: 81,649,009	S1756P	unknown	Het
Ep300	T	A	15: 81,611,410		probably benign	Het
Fam166a	T	C	2: 25,220,288	S71P	probably benign	Het
Fgd4	T	C	16: 16,437,032	Q507R	probably damaging	Het
Frem3	A	G	8: 80,616,075	T1666A	probably benign	Het
Frmd4a	C	A	2: 4,603,679	A786E	possibly damaging	Het
Gabrr1	C	T	4: 33,158,175	T266I	possibly damaging	Het
Gm11563	G	A	11: 99,658,449	P160S	unknown	Het
Gm12166	T	C	11: 46,051,852	D148G	probably damaging	Het
Gm12790	T	C	4: 101,968,127	D30G	probably benign	Het
Haus8	A	G	8: 71,263,092	V34A	probably damaging	Het
Hgf	T	C	5: 16,572,601	Y199H	probably benign	Het
Ide	G	A	19: 37,272,205	P916L	unknown	Het
Igsf10	G	T	3: 59,330,100	H887N	probably benign	Het
Iigp1	A	T	18: 60,390,146	H112L	probably benign	Het
Impg2	A	G	16: 56,261,732	E1009G	probably damaging	Het
Khdc1a	A	C	1: 21,350,429	D91A	probably damaging	Het
Klk12	A	G	7: 43,773,243	D198G	probably damaging	Het
Kntc1	T	G	5: 123,765,955	L345R	probably damaging	Het
Kprp	T	C	3: 92,823,964	N593S	probably benign	Het
Krt2	T	G	15: 101,814,486	D359A	probably damaging	Het
Krt35	A	T	11: 100,095,899	N96K	probably benign	Het
Lnx1	T	C	5: 74,685,543	D82G	probably damaging	Het
Mroh2a	A	G	1: 88,258,664	S64G	probably benign	Het
Nfib	A	T	4: 82,296,811	S518R	probably damaging	Het
Nol6	T	C	4: 41,120,299	I473V	probably benign	Het
Obscn	T	C	11: 59,122,772	D1108G	probably damaging	Het
Olfr553	A	T	7: 102,614,769	C73*	probably null	Het
Olfr834	C	A	9: 18,988,705	S239*	probably null	Het
Otop1	T	C	5: 38,299,721	Y275H	probably damaging	Het
Ppp1r14c	G	T	10: 3,366,912	K82N	probably damaging	Het
Prr14l	T	C	5: 32,793,644	E1935G	probably damaging	Het
Ptprd	C	T	4: 76,243,786	V78I	possibly damaging	Het
Rfc4	T	A	16: 23,114,429		probably benign	Het
Rpn2	C	A	2: 157,295,324	A209E	probably damaging	Het
Sf1	T	C	19: 6,375,913		probably benign	Het
Skint5	T	A	4: 113,667,193	S864C	unknown	Het
Slc2a10	C	G	2: 165,516,321	N455K	probably damaging	Het
Snrnp200	T	A	2: 127,235,066	I1673N	probably benign	Het
Sri	G	T	5: 8,063,693	G152W	probably damaging	Het
Srpr	T	C	9: 35,214,608	I394T	possibly damaging	Het
Svop	C	T	5: 114,065,682	V13M	probably damaging	Het
Traf3ip2	A	G	10: 39,634,654	N308D	probably damaging	Het
Uhrf1bp1	T	C	17: 27,887,503	V1001A	probably benign	Het
Vmn2r125	T	A	4: 156,349,977	D19E	probably null	Het
Vmn2r16	A	T	5: 109,363,799	Y624F	possibly damaging	Het

Other mutations in Auts2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01739:Auts2	APN	5	131440218	missense	probably benign	0.00
IGL01751:Auts2	APN	5	131472360	missense	probably damaging	0.99
IGL02070:Auts2	APN	5	131470421	missense	probably damaging	1.00
R0032:Auts2	UTSW	5	131440093	missense	probably damaging	1.00
R0033:Auts2	UTSW	5	131440093	missense	probably damaging	1.00
R0046:Auts2	UTSW	5	131770785	exon	noncoding transcript
R0399:Auts2	UTSW	5	131440524	missense	probably benign	0.37
R0412:Auts2	UTSW	5	131446831	missense	probably benign	0.02
R0551:Auts2	UTSW	5	131440469	missense	possibly damaging	0.75
R1536:Auts2	UTSW	5	131487463	intron	probably benign
R1573:Auts2	UTSW	5	131440487	missense	probably damaging	1.00
R1789:Auts2	UTSW	5	131472450	missense	probably damaging	1.00
R1912:Auts2	UTSW	5	131443574	missense	probably damaging	1.00
R2431:Auts2	UTSW	5	132259048	nonsense	probably null
R3745:Auts2	UTSW	5	131476587	utr 5 prime	probably benign
R4290:Auts2	UTSW	5	131474971	missense	probably damaging	1.00
R4576:Auts2	UTSW	5	132258934	missense	probably benign	0.17
R4578:Auts2	UTSW	5	132258934	missense	probably benign	0.17
R4623:Auts2	UTSW	5	131440383	missense	probably benign	0.25
R4632:Auts2	UTSW	5	131472275	missense	probably damaging	1.00
R4663:Auts2	UTSW	5	131439638	missense	probably damaging	1.00
R4835:Auts2	UTSW	5	131466093	missense	probably damaging	1.00
R4881:Auts2	UTSW	5	131472450	missense	probably damaging	1.00
R5030:Auts2	UTSW	5	131443498	missense	probably benign	0.00
R5032:Auts2	UTSW	5	131476891	utr 5 prime	probably benign
R5078:Auts2	UTSW	5	132258947	missense	possibly damaging	0.85
R5093:Auts2	UTSW	5	131439458	missense	probably damaging	0.99
R5182:Auts2	UTSW	5	131475081	missense	probably null	0.01
R5305:Auts2	UTSW	5	131443794	intron	probably benign
R5429:Auts2	UTSW	5	131472335	missense	probably damaging	1.00
R5601:Auts2	UTSW	5	131476823	utr 5 prime	probably benign
R5725:Auts2	UTSW	5	131439746	missense	probably benign	0.35
R5990:Auts2	UTSW	5	131476895	utr 5 prime	probably benign
R6074:Auts2	UTSW	5	131476989	utr 5 prime	probably benign
R6130:Auts2	UTSW	5	131440223	missense	probably damaging	1.00
R6321:Auts2	UTSW	5	131466115	missense	probably damaging	1.00
R6974:Auts2	UTSW	5	131440599	missense	probably benign	0.01
R7000:Auts2	UTSW	5	131440218	missense	probably benign	0.01
R7014:Auts2	UTSW	5	131466123	missense	probably damaging	1.00
R7154:Auts2	UTSW	5	131451893	missense
R7812:Auts2	UTSW	5	131472446	missense
R7922:Auts2	UTSW	5	131440373	missense
R8159:Auts2	UTSW	5	131460125	critical splice donor site	probably null
R8553:Auts2	UTSW	5	131440143	missense	probably benign	0.00
R8873:Auts2	UTSW	5	131443664	missense
R8970:Auts2	UTSW	5	132258952	missense	possibly damaging	0.52
R9348:Auts2	UTSW	5	131461317	missense
R9500:Auts2	UTSW	5	131476781	missense	unknown
Z1088:Auts2	UTSW	5	131476554	splice site	probably benign

Predicted Primers

PCR Primer
(F):5'- ATTACATGGAGATCTGACACACAG -3'
(R):5'- TGCGGAGAAACGACAGACTC -3'

Sequencing Primer
(F):5'- CCAATGGAAGAGTGTTAGTCAAATAC -3'
(R):5'- GGAGAAACGACAGACTCCCCTG -3'

Posted On

2015-09-24