Incidental Mutation 'R0346:Mybph'
ID34240
Institutional Source Beutler Lab
Gene Symbol Mybph
Ensembl Gene ENSMUSG00000042451
Gene Namemyosin binding protein H
Synonyms
MMRRC Submission 038553-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R0346 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location134193448-134201232 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 134197754 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 279 (I279S)
Ref Sequence ENSEMBL: ENSMUSP00000141104 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038191] [ENSMUST00000038445] [ENSMUST00000086465] [ENSMUST00000169927] [ENSMUST00000191577]
Predicted Effect probably benign
Transcript: ENSMUST00000038191
SMART Domains Protein: ENSMUSP00000043522
Gene: ENSMUSG00000042429

DomainStartEndE-ValueType
Pfam:7tm_4 17 305 1.1e-10 PFAM
Pfam:7TM_GPCR_Srsx 20 303 5e-14 PFAM
Pfam:7tm_1 26 288 9.8e-52 PFAM
low complexity region 311 323 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000038445
AA Change: I279S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000042195
Gene: ENSMUSG00000042451
AA Change: I279S

DomainStartEndE-ValueType
low complexity region 41 66 N/A INTRINSIC
FN3 77 160 4.84e-9 SMART
IG 187 270 9.78e-7 SMART
FN3 273 355 1.1e-7 SMART
IGc2 400 467 1.38e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000086465
SMART Domains Protein: ENSMUSP00000083656
Gene: ENSMUSG00000042429

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 20 303 5e-14 PFAM
Pfam:7tm_1 26 288 1.9e-63 PFAM
low complexity region 311 323 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169927
SMART Domains Protein: ENSMUSP00000132105
Gene: ENSMUSG00000042429

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 20 303 5e-14 PFAM
Pfam:7tm_1 26 288 1.9e-63 PFAM
low complexity region 311 323 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000191577
AA Change: I279S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000141104
Gene: ENSMUSG00000042451
AA Change: I279S

DomainStartEndE-ValueType
low complexity region 41 66 N/A INTRINSIC
FN3 77 160 4.84e-9 SMART
IG 187 270 9.78e-7 SMART
FN3 273 355 1.1e-7 SMART
IGc2 400 467 1.38e-6 SMART
Meta Mutation Damage Score 0.4548 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.4%
Validation Efficiency 100% (79/79)
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,566,278 I4406L probably damaging Het
Abca16 T A 7: 120,435,932 C314S probably damaging Het
Add3 C T 19: 53,216,956 R46* probably null Het
Alas1 A T 9: 106,243,351 S82T possibly damaging Het
Alkbh5 C G 11: 60,538,741 R107G possibly damaging Het
Ap3b1 A T 13: 94,445,971 R365* probably null Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
AU021092 T C 16: 5,216,854 D168G possibly damaging Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Caln1 C A 5: 130,822,921 H184N possibly damaging Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Ccdc191 T C 16: 43,938,952 V372A probably damaging Het
Ccng2 T G 5: 93,270,894 I126S probably damaging Het
Cep85 A T 4: 134,132,422 N643K probably damaging Het
Clvs2 G C 10: 33,622,546 S129R possibly damaging Het
Cntn1 G T 15: 92,232,087 probably benign Het
Cttn A T 7: 144,452,539 probably benign Het
Dedd2 T C 7: 25,211,269 S161G possibly damaging Het
Dnajb13 T C 7: 100,503,925 D263G probably damaging Het
Dppa4 T A 16: 48,289,324 probably benign Het
Ear2 A G 14: 44,102,906 E7G probably damaging Het
Eif2b4 A G 5: 31,188,108 probably benign Het
Etl4 G T 2: 20,759,652 probably null Het
Fbxo15 T A 18: 84,960,221 probably null Het
Gm8765 T C 13: 50,703,310 Y995H probably benign Het
Gm9970 A G 5: 31,240,838 probably benign Het
Hap1 A G 11: 100,356,029 S17P probably benign Het
Hgd C T 16: 37,588,774 probably benign Het
Inpp5f T A 7: 128,690,668 L16Q probably damaging Het
Islr2 G A 9: 58,198,343 R545* probably null Het
Itgav G T 2: 83,792,609 C675F probably damaging Het
Kif13a T A 13: 46,814,219 I403L possibly damaging Het
Kif14 T A 1: 136,468,160 I68N probably damaging Het
Kif26a G T 12: 112,179,348 K1764N probably null Het
Lrrd1 C A 5: 3,850,215 F173L probably benign Het
Mroh4 G C 15: 74,614,292 probably benign Het
Mrvi1 T C 7: 110,898,976 D404G probably damaging Het
Msh5 A G 17: 35,029,888 V723A probably benign Het
Myh4 A T 11: 67,260,326 I1936L probably benign Het
Myo1h A T 5: 114,355,209 T704S probably benign Het
Nav2 C A 7: 49,604,585 T2377K probably benign Het
Nipbl T G 15: 8,360,956 Q276H probably damaging Het
Nlrp9b T C 7: 20,024,515 L559P probably damaging Het
Nup210l T A 3: 90,189,438 V1318E probably damaging Het
Olfr1427 A T 19: 12,099,439 S67T probably damaging Het
Olfr18 A G 9: 20,314,411 S170P probably benign Het
Olfr385 A G 11: 73,589,457 Y94H probably damaging Het
Olfr765 C A 10: 129,046,473 V197F possibly damaging Het
P2ry13 T C 3: 59,209,566 T264A possibly damaging Het
Plekhg5 T C 4: 152,114,253 L966P probably benign Het
Prss35 A G 9: 86,755,351 K58R probably benign Het
Ptafr T A 4: 132,580,079 L260* probably null Het
Pum1 A T 4: 130,779,805 T1157S possibly damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rnf145 A G 11: 44,555,164 Y275C probably damaging Het
Rpl6 A T 5: 121,208,491 K218N possibly damaging Het
Rps6 T C 4: 86,855,981 T128A probably benign Het
Ryr1 G T 7: 29,067,588 probably benign Het
Scel A T 14: 103,529,984 Q26H probably damaging Het
Sfxn4 A T 19: 60,858,673 D57E probably benign Het
Slc35d1 A C 4: 103,190,847 L240R probably damaging Het
Smcr8 A G 11: 60,779,750 I575V probably benign Het
Syk G A 13: 52,640,659 M476I probably damaging Het
Tbcel A T 9: 42,437,243 probably benign Het
Tob2 C A 15: 81,858,223 G65W probably damaging Het
Trim16 A G 11: 62,840,694 N464D probably benign Het
Trim36 T C 18: 46,199,709 probably benign Het
Trpv4 C A 5: 114,630,529 probably benign Het
Tsga10 T A 1: 37,840,519 T64S possibly damaging Het
Ttc26 T C 6: 38,409,435 C364R probably damaging Het
Vars2 A T 17: 35,664,864 probably benign Het
Vmn1r72 C A 7: 11,669,694 V276L probably benign Het
Vps13a T A 19: 16,677,969 K1898N probably benign Het
Vps18 A G 2: 119,297,164 M823V probably damaging Het
Washc2 T C 6: 116,220,523 probably benign Het
Zfp763 A T 17: 33,019,747 H141Q probably benign Het
Other mutations in Mybph
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01960:Mybph APN 1 134193925 missense probably benign 0.02
IGL02312:Mybph APN 1 134197450 missense probably damaging 0.99
PIT4581001:Mybph UTSW 1 134194741 missense probably benign 0.00
R0055:Mybph UTSW 1 134193852 missense probably damaging 0.99
R0055:Mybph UTSW 1 134193852 missense probably damaging 0.99
R0669:Mybph UTSW 1 134197343 splice site probably null
R0765:Mybph UTSW 1 134197496 missense possibly damaging 0.78
R1349:Mybph UTSW 1 134193615 missense probably benign 0.00
R1662:Mybph UTSW 1 134193636 missense probably benign 0.01
R1728:Mybph UTSW 1 134197480 missense probably benign 0.00
R1729:Mybph UTSW 1 134197480 missense probably benign 0.00
R1730:Mybph UTSW 1 134197480 missense probably benign 0.00
R1739:Mybph UTSW 1 134197480 missense probably benign 0.00
R1762:Mybph UTSW 1 134197480 missense probably benign 0.00
R1783:Mybph UTSW 1 134197480 missense probably benign 0.00
R1784:Mybph UTSW 1 134197480 missense probably benign 0.00
R1785:Mybph UTSW 1 134197480 missense probably benign 0.00
R1978:Mybph UTSW 1 134196996 missense probably benign 0.01
R2058:Mybph UTSW 1 134200119 missense probably damaging 1.00
R3115:Mybph UTSW 1 134194738 missense probably benign
R4841:Mybph UTSW 1 134198495 missense probably damaging 1.00
R4842:Mybph UTSW 1 134198495 missense probably damaging 1.00
R5208:Mybph UTSW 1 134193535 missense probably benign
R7561:Mybph UTSW 1 134193727 critical splice donor site probably null
R7787:Mybph UTSW 1 134197508 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTGGAAGCCAAGGCCAGCATTGAC -3'
(R):5'- AGGATGAACCTTTTGAGCCCCGAC -3'

Sequencing Primer
(F):5'- GGGCTGTCTCGAAACCATAG -3'
(R):5'- TTTGAGCCCCGACTACTTC -3'
Posted On2013-05-09