Incidental Mutation 'R4575:Olfr553'
ID342403
Institutional Source Beutler Lab
Gene Symbol Olfr553
Ensembl Gene ENSMUSG00000073972
Gene Nameolfactory receptor 553
SynonymsMOR25-2, GA_x6K02T2PBJ9-5333671-5332712
MMRRC Submission 041798-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R4575 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location102611281-102618218 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 102614769 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 73 (C73*)
Ref Sequence ENSEMBL: ENSMUSP00000149901 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098222] [ENSMUST00000216776]
Predicted Effect probably null
Transcript: ENSMUST00000098222
AA Change: C73*
SMART Domains Protein: ENSMUSP00000095825
Gene: ENSMUSG00000073972
AA Change: C73*

DomainStartEndE-ValueType
Pfam:7tm_4 40 319 1.1e-108 PFAM
Pfam:7TM_GPCR_Srsx 44 158 1.3e-9 PFAM
Pfam:7tm_1 50 302 4.9e-19 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000216776
AA Change: C73*
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057M21Rik C T 7: 131,362,596 A26T probably benign Het
4930408O17Rik C A 12: 104,871,268 noncoding transcript Het
Adgrf3 T A 5: 30,202,257 M224L probably benign Het
Ago3 T C 4: 126,346,682 H129R probably benign Het
Asb10 C T 5: 24,540,054 R99H probably damaging Het
Auts2 C T 5: 132,258,934 G70E probably benign Het
Ccdc96 T C 5: 36,486,075 V475A possibly damaging Het
Clec4b2 T A 6: 123,173,680 L16Q probably damaging Het
Cyp2c68 T A 19: 39,734,361 I248L probably benign Het
Cyp2d22 G T 15: 82,371,932 A167E possibly damaging Het
Doxl2 C T 6: 48,977,568 Q547* probably null Het
Dpysl3 T C 18: 43,342,247 K382R probably damaging Het
Dscam A G 16: 96,825,623 I362T possibly damaging Het
Edil3 T C 13: 89,319,731 Y452H probably damaging Het
Elfn1 T C 5: 139,972,053 S271P probably benign Het
Ep300 T C 15: 81,649,009 S1756P unknown Het
Ep300 T A 15: 81,611,410 probably benign Het
Fam166a T C 2: 25,220,288 S71P probably benign Het
Fgd4 T C 16: 16,437,032 Q507R probably damaging Het
Frem3 A G 8: 80,616,075 T1666A probably benign Het
Frmd4a C A 2: 4,603,679 A786E possibly damaging Het
Gabrr1 C T 4: 33,158,175 T266I possibly damaging Het
Gm11563 G A 11: 99,658,449 P160S unknown Het
Gm12166 T C 11: 46,051,852 D148G probably damaging Het
Gm12790 T C 4: 101,968,127 D30G probably benign Het
Haus8 A G 8: 71,263,092 V34A probably damaging Het
Hgf T C 5: 16,572,601 Y199H probably benign Het
Ide G A 19: 37,272,205 P916L unknown Het
Igsf10 G T 3: 59,330,100 H887N probably benign Het
Iigp1 A T 18: 60,390,146 H112L probably benign Het
Impg2 A G 16: 56,261,732 E1009G probably damaging Het
Khdc1a A C 1: 21,350,429 D91A probably damaging Het
Klk12 A G 7: 43,773,243 D198G probably damaging Het
Kntc1 T G 5: 123,765,955 L345R probably damaging Het
Kprp T C 3: 92,823,964 N593S probably benign Het
Krt2 T G 15: 101,814,486 D359A probably damaging Het
Krt35 A T 11: 100,095,899 N96K probably benign Het
Lnx1 T C 5: 74,685,543 D82G probably damaging Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Nfib A T 4: 82,296,811 S518R probably damaging Het
Nol6 T C 4: 41,120,299 I473V probably benign Het
Obscn T C 11: 59,122,772 D1108G probably damaging Het
Olfr834 C A 9: 18,988,705 S239* probably null Het
Otop1 T C 5: 38,299,721 Y275H probably damaging Het
Ppp1r14c G T 10: 3,366,912 K82N probably damaging Het
Prr14l T C 5: 32,793,644 E1935G probably damaging Het
Ptprd C T 4: 76,243,786 V78I possibly damaging Het
Rfc4 T A 16: 23,114,429 probably benign Het
Rpn2 C A 2: 157,295,324 A209E probably damaging Het
Sf1 T C 19: 6,375,913 probably benign Het
Skint5 T A 4: 113,667,193 S864C unknown Het
Slc2a10 C G 2: 165,516,321 N455K probably damaging Het
Snrnp200 T A 2: 127,235,066 I1673N probably benign Het
Sri G T 5: 8,063,693 G152W probably damaging Het
Srpr T C 9: 35,214,608 I394T possibly damaging Het
Svop C T 5: 114,065,682 V13M probably damaging Het
Traf3ip2 A G 10: 39,634,654 N308D probably damaging Het
Uhrf1bp1 T C 17: 27,887,503 V1001A probably benign Het
Vmn2r125 T A 4: 156,349,977 D19E probably null Het
Vmn2r16 A T 5: 109,363,799 Y624F possibly damaging Het
Other mutations in Olfr553
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01359:Olfr553 APN 7 102614172 missense probably benign 0.18
IGL01957:Olfr553 APN 7 102614339 missense probably damaging 0.98
IGL02720:Olfr553 APN 7 102614839 missense probably damaging 1.00
IGL03052:Olfr553 UTSW 7 102614449 missense probably benign 0.00
R1812:Olfr553 UTSW 7 102614370 missense possibly damaging 0.95
R1994:Olfr553 UTSW 7 102614540 missense probably damaging 0.97
R3406:Olfr553 UTSW 7 102614786 missense possibly damaging 0.92
R5527:Olfr553 UTSW 7 102614561 missense probably benign
R6823:Olfr553 UTSW 7 102614486 missense probably damaging 0.99
R7224:Olfr553 UTSW 7 102614767 missense probably damaging 1.00
R7603:Olfr553 UTSW 7 102614938 missense probably benign
R7823:Olfr553 UTSW 7 102614957 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACATAGCGGTCGAAAGCCATG -3'
(R):5'- GAGAGCACCTCTATGTATCCCAC -3'

Sequencing Primer
(F):5'- CGGTCGAAAGCCATGGCAAG -3'
(R):5'- TAATGCCTGCTCAGTACCCAG -3'
Posted On2015-09-24