Incidental Mutation 'R4575:Edil3'
ID342418
Institutional Source Beutler Lab
Gene Symbol Edil3
Ensembl Gene ENSMUSG00000034488
Gene NameEGF-like repeats and discoidin I-like domains 3
SynonymsDel-1, developmental endothelial locus-1, Del1
MMRRC Submission 041798-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4575 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location88821472-89323223 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89319731 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 452 (Y452H)
Ref Sequence ENSEMBL: ENSMUSP00000080462 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043111] [ENSMUST00000081769]
Predicted Effect probably benign
Transcript: ENSMUST00000043111
AA Change: Y442H

PolyPhen 2 Score 0.282 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000044652
Gene: ENSMUSG00000034488
AA Change: Y442H

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF 25 60 2.03e-6 SMART
EGF 67 107 1.62e-5 SMART
EGF_CA 109 145 4.32e-10 SMART
FA58C 147 304 3.7e-58 SMART
FA58C 308 466 1.44e-37 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000081769
AA Change: Y452H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080462
Gene: ENSMUSG00000034488
AA Change: Y452H

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF 25 60 2.03e-6 SMART
EGF 77 117 1.62e-5 SMART
EGF_CA 119 155 4.32e-10 SMART
FA58C 157 314 3.7e-58 SMART
FA58C 318 476 1.44e-37 SMART
Meta Mutation Damage Score 0.0915 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an integrin ligand. It plays an important role in mediating angiogenesis and may be important in vessel wall remodeling and development. It also influences endothelial cell behavior. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation are viable and fertile with no noticeable fur phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057M21Rik C T 7: 131,362,596 A26T probably benign Het
4930408O17Rik C A 12: 104,871,268 noncoding transcript Het
Adgrf3 T A 5: 30,202,257 M224L probably benign Het
Ago3 T C 4: 126,346,682 H129R probably benign Het
Asb10 C T 5: 24,540,054 R99H probably damaging Het
Auts2 C T 5: 132,258,934 G70E probably benign Het
Ccdc96 T C 5: 36,486,075 V475A possibly damaging Het
Clec4b2 T A 6: 123,173,680 L16Q probably damaging Het
Cyp2c68 T A 19: 39,734,361 I248L probably benign Het
Cyp2d22 G T 15: 82,371,932 A167E possibly damaging Het
Doxl2 C T 6: 48,977,568 Q547* probably null Het
Dpysl3 T C 18: 43,342,247 K382R probably damaging Het
Dscam A G 16: 96,825,623 I362T possibly damaging Het
Elfn1 T C 5: 139,972,053 S271P probably benign Het
Ep300 T C 15: 81,649,009 S1756P unknown Het
Ep300 T A 15: 81,611,410 probably benign Het
Fam166a T C 2: 25,220,288 S71P probably benign Het
Fgd4 T C 16: 16,437,032 Q507R probably damaging Het
Frem3 A G 8: 80,616,075 T1666A probably benign Het
Frmd4a C A 2: 4,603,679 A786E possibly damaging Het
Gabrr1 C T 4: 33,158,175 T266I possibly damaging Het
Gm11563 G A 11: 99,658,449 P160S unknown Het
Gm12166 T C 11: 46,051,852 D148G probably damaging Het
Gm12790 T C 4: 101,968,127 D30G probably benign Het
Haus8 A G 8: 71,263,092 V34A probably damaging Het
Hgf T C 5: 16,572,601 Y199H probably benign Het
Ide G A 19: 37,272,205 P916L unknown Het
Igsf10 G T 3: 59,330,100 H887N probably benign Het
Iigp1 A T 18: 60,390,146 H112L probably benign Het
Impg2 A G 16: 56,261,732 E1009G probably damaging Het
Khdc1a A C 1: 21,350,429 D91A probably damaging Het
Klk12 A G 7: 43,773,243 D198G probably damaging Het
Kntc1 T G 5: 123,765,955 L345R probably damaging Het
Kprp T C 3: 92,823,964 N593S probably benign Het
Krt2 T G 15: 101,814,486 D359A probably damaging Het
Krt35 A T 11: 100,095,899 N96K probably benign Het
Lnx1 T C 5: 74,685,543 D82G probably damaging Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Nfib A T 4: 82,296,811 S518R probably damaging Het
Nol6 T C 4: 41,120,299 I473V probably benign Het
Obscn T C 11: 59,122,772 D1108G probably damaging Het
Olfr553 A T 7: 102,614,769 C73* probably null Het
Olfr834 C A 9: 18,988,705 S239* probably null Het
Otop1 T C 5: 38,299,721 Y275H probably damaging Het
Ppp1r14c G T 10: 3,366,912 K82N probably damaging Het
Prr14l T C 5: 32,793,644 E1935G probably damaging Het
Ptprd C T 4: 76,243,786 V78I possibly damaging Het
Rfc4 T A 16: 23,114,429 probably benign Het
Rpn2 C A 2: 157,295,324 A209E probably damaging Het
Sf1 T C 19: 6,375,913 probably benign Het
Skint5 T A 4: 113,667,193 S864C unknown Het
Slc2a10 C G 2: 165,516,321 N455K probably damaging Het
Snrnp200 T A 2: 127,235,066 I1673N probably benign Het
Sri G T 5: 8,063,693 G152W probably damaging Het
Srpr T C 9: 35,214,608 I394T possibly damaging Het
Svop C T 5: 114,065,682 V13M probably damaging Het
Traf3ip2 A G 10: 39,634,654 N308D probably damaging Het
Uhrf1bp1 T C 17: 27,887,503 V1001A probably benign Het
Vmn2r125 T A 4: 156,349,977 D19E probably null Het
Vmn2r16 A T 5: 109,363,799 Y624F possibly damaging Het
Other mutations in Edil3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00900:Edil3 APN 13 89289533 missense probably benign 0.40
IGL01628:Edil3 APN 13 89319826 utr 3 prime probably benign
IGL02112:Edil3 APN 13 89180255 missense probably damaging 1.00
IGL03123:Edil3 APN 13 89131736 missense probably damaging 1.00
R0402:Edil3 UTSW 13 89199451 splice site probably benign
R0608:Edil3 UTSW 13 89184849 missense probably damaging 1.00
R0675:Edil3 UTSW 13 89177280 missense probably damaging 0.96
R0735:Edil3 UTSW 13 89177178 missense probably damaging 0.97
R0991:Edil3 UTSW 13 89289506 nonsense probably null
R1507:Edil3 UTSW 13 89131712 missense probably damaging 1.00
R1643:Edil3 UTSW 13 89289576 critical splice donor site probably null
R2008:Edil3 UTSW 13 88944953 splice site probably null
R3703:Edil3 UTSW 13 89177298 missense probably benign 0.01
R4206:Edil3 UTSW 13 89180278 missense probably damaging 1.00
R4258:Edil3 UTSW 13 89177153 missense probably damaging 1.00
R4570:Edil3 UTSW 13 89131897 intron probably benign
R4576:Edil3 UTSW 13 89319731 missense probably damaging 1.00
R4654:Edil3 UTSW 13 89289470 missense probably damaging 1.00
R5420:Edil3 UTSW 13 89131772 missense probably damaging 1.00
R5446:Edil3 UTSW 13 89184838 missense possibly damaging 0.65
R5534:Edil3 UTSW 13 89199474 missense probably benign 0.00
R5653:Edil3 UTSW 13 89131812 missense probably damaging 1.00
R5663:Edil3 UTSW 13 89042508 missense probably damaging 0.99
R5664:Edil3 UTSW 13 89319713 missense probably damaging 1.00
R6179:Edil3 UTSW 13 88821989 missense probably benign
R6254:Edil3 UTSW 13 89319729 missense probably damaging 1.00
R6813:Edil3 UTSW 13 89289456 missense probably damaging 1.00
R7138:Edil3 UTSW 13 89131728 missense probably damaging 1.00
R7215:Edil3 UTSW 13 88822050 critical splice donor site probably null
R7295:Edil3 UTSW 13 89131783 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GATCCTCAAACATCCATGCCTTTG -3'
(R):5'- AGTTTCCATCAGCTTCACACAGTTC -3'

Sequencing Primer
(F):5'- TCAAACATCCATGCCTTTGTATAC -3'
(R):5'- CACACAGTTCATTTCGTGGAG -3'
Posted On2015-09-24