Incidental Mutation 'R4575:Dscam'
ID342424
Institutional Source Beutler Lab
Gene Symbol Dscam
Ensembl Gene ENSMUSG00000050272
Gene NameDS cell adhesion molecule
Synonyms4932410A21Rik
MMRRC Submission 041798-MU
Accession Numbers

Genbank: NM_031174; MGI: 1196281

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4575 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location96592079-97170752 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 96825623 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 362 (I362T)
Ref Sequence ENSEMBL: ENSMUSP00000056040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056102]
Predicted Effect possibly damaging
Transcript: ENSMUST00000056102
AA Change: I362T

PolyPhen 2 Score 0.821 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000056040
Gene: ENSMUSG00000050272
AA Change: I362T

DomainStartEndE-ValueType
IG_like 37 109 1.47e0 SMART
IG 130 218 8.33e-1 SMART
IGc2 237 300 8.7e-13 SMART
IGc2 326 392 1.24e-8 SMART
IGc2 419 491 1.1e-9 SMART
IGc2 516 582 1.99e-7 SMART
IGc2 608 676 1.84e-11 SMART
IGc2 702 773 6.01e-16 SMART
IG 794 883 1.73e-7 SMART
FN3 885 969 7.34e-9 SMART
FN3 985 1073 4.06e-11 SMART
FN3 1088 1174 7.23e-8 SMART
FN3 1189 1270 2.6e-9 SMART
IGc2 1301 1366 2.05e-9 SMART
FN3 1380 1460 7.17e-12 SMART
FN3 1477 1557 4.35e1 SMART
transmembrane domain 1595 1617 N/A INTRINSIC
low complexity region 1799 1809 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype Strain: 4830358; 3840666;5305025;3761008
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the immunoglobulin superfamily of cell adhesion molecules (Ig-CAMs), and is involved in human central and peripheral nervous system development. This gene is a candidate for Down syndrome and congenital heart disease (DSCHD). A gene encoding a similar Ig-CAM protein is located on chromosome 11. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit background-sensitive perinatal lethality associated with respiratory distress, altered C4 ventral root and pre-inspiratory neuron signaling, and abnormal response to hypercapnia. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted(6) Gene trapped(1) Spontaneous(2)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057M21Rik C T 7: 131,362,596 A26T probably benign Het
4930408O17Rik C A 12: 104,871,268 noncoding transcript Het
Adgrf3 T A 5: 30,202,257 M224L probably benign Het
Ago3 T C 4: 126,346,682 H129R probably benign Het
Asb10 C T 5: 24,540,054 R99H probably damaging Het
Auts2 C T 5: 132,258,934 G70E probably benign Het
Ccdc96 T C 5: 36,486,075 V475A possibly damaging Het
Clec4b2 T A 6: 123,173,680 L16Q probably damaging Het
Cyp2c68 T A 19: 39,734,361 I248L probably benign Het
Cyp2d22 G T 15: 82,371,932 A167E possibly damaging Het
Doxl2 C T 6: 48,977,568 Q547* probably null Het
Dpysl3 T C 18: 43,342,247 K382R probably damaging Het
Edil3 T C 13: 89,319,731 Y452H probably damaging Het
Elfn1 T C 5: 139,972,053 S271P probably benign Het
Ep300 T C 15: 81,649,009 S1756P unknown Het
Ep300 T A 15: 81,611,410 probably benign Het
Fam166a T C 2: 25,220,288 S71P probably benign Het
Fgd4 T C 16: 16,437,032 Q507R probably damaging Het
Frem3 A G 8: 80,616,075 T1666A probably benign Het
Frmd4a C A 2: 4,603,679 A786E possibly damaging Het
Gabrr1 C T 4: 33,158,175 T266I possibly damaging Het
Gm11563 G A 11: 99,658,449 P160S unknown Het
Gm12166 T C 11: 46,051,852 D148G probably damaging Het
Gm12790 T C 4: 101,968,127 D30G probably benign Het
Haus8 A G 8: 71,263,092 V34A probably damaging Het
Hgf T C 5: 16,572,601 Y199H probably benign Het
Ide G A 19: 37,272,205 P916L unknown Het
Igsf10 G T 3: 59,330,100 H887N probably benign Het
Iigp1 A T 18: 60,390,146 H112L probably benign Het
Impg2 A G 16: 56,261,732 E1009G probably damaging Het
Khdc1a A C 1: 21,350,429 D91A probably damaging Het
Klk12 A G 7: 43,773,243 D198G probably damaging Het
Kntc1 T G 5: 123,765,955 L345R probably damaging Het
Kprp T C 3: 92,823,964 N593S probably benign Het
Krt2 T G 15: 101,814,486 D359A probably damaging Het
Krt35 A T 11: 100,095,899 N96K probably benign Het
Lnx1 T C 5: 74,685,543 D82G probably damaging Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Nfib A T 4: 82,296,811 S518R probably damaging Het
Nol6 T C 4: 41,120,299 I473V probably benign Het
Obscn T C 11: 59,122,772 D1108G probably damaging Het
Olfr553 A T 7: 102,614,769 C73* probably null Het
Olfr834 C A 9: 18,988,705 S239* probably null Het
Otop1 T C 5: 38,299,721 Y275H probably damaging Het
Ppp1r14c G T 10: 3,366,912 K82N probably damaging Het
Prr14l T C 5: 32,793,644 E1935G probably damaging Het
Ptprd C T 4: 76,243,786 V78I possibly damaging Het
Rfc4 T A 16: 23,114,429 probably benign Het
Rpn2 C A 2: 157,295,324 A209E probably damaging Het
Sf1 T C 19: 6,375,913 probably benign Het
Skint5 T A 4: 113,667,193 S864C unknown Het
Slc2a10 C G 2: 165,516,321 N455K probably damaging Het
Snrnp200 T A 2: 127,235,066 I1673N probably benign Het
Sri G T 5: 8,063,693 G152W probably damaging Het
Srpr T C 9: 35,214,608 I394T possibly damaging Het
Svop C T 5: 114,065,682 V13M probably damaging Het
Traf3ip2 A G 10: 39,634,654 N308D probably damaging Het
Uhrf1bp1 T C 17: 27,887,503 V1001A probably benign Het
Vmn2r125 T A 4: 156,349,977 D19E probably null Het
Vmn2r16 A T 5: 109,363,799 Y624F possibly damaging Het
Other mutations in Dscam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Dscam APN 16 96608065 missense possibly damaging 0.64
IGL00841:Dscam APN 16 96819877 missense probably damaging 1.00
IGL01289:Dscam APN 16 96643882 nonsense probably null
IGL01358:Dscam APN 16 96610343 missense possibly damaging 0.68
IGL01431:Dscam APN 16 96652078 critical splice donor site probably null
IGL01444:Dscam APN 16 96673709 missense possibly damaging 0.95
IGL01767:Dscam APN 16 96654936 missense probably damaging 1.00
IGL01866:Dscam APN 16 96685350 missense probably benign 0.06
IGL02020:Dscam APN 16 96716069 missense probably damaging 1.00
IGL02023:Dscam APN 16 96801197 missense probably benign 0.06
IGL02057:Dscam APN 16 96716073 nonsense probably null
IGL02389:Dscam APN 16 96640897 missense probably benign 0.27
IGL02409:Dscam APN 16 96819888 missense possibly damaging 0.46
IGL02694:Dscam APN 16 96593276 missense probably benign 0.00
IGL02899:Dscam APN 16 96709247 missense probably damaging 0.98
IGL02956:Dscam APN 16 96801272 missense probably damaging 0.98
IGL03035:Dscam APN 16 96819970 missense possibly damaging 0.94
IGL03191:Dscam APN 16 96820769 missense probably benign 0.36
F6893:Dscam UTSW 16 97056460 missense possibly damaging 0.78
K3955:Dscam UTSW 16 96673687 missense probably benign 0.00
R0024:Dscam UTSW 16 96593385 nonsense probably null
R0057:Dscam UTSW 16 96673736 missense probably damaging 1.00
R0057:Dscam UTSW 16 96673736 missense probably damaging 1.00
R0117:Dscam UTSW 16 96673678 missense probably benign 0.33
R0211:Dscam UTSW 16 96716079 missense possibly damaging 0.50
R0280:Dscam UTSW 16 97039006 missense possibly damaging 0.62
R0355:Dscam UTSW 16 96654905 missense probably benign 0.00
R0380:Dscam UTSW 16 97056610 missense probably damaging 1.00
R0445:Dscam UTSW 16 96772503 missense probably damaging 1.00
R0492:Dscam UTSW 16 96825782 splice site probably null
R0534:Dscam UTSW 16 96652172 missense possibly damaging 0.67
R0593:Dscam UTSW 16 96772408 missense probably benign 0.19
R0707:Dscam UTSW 16 96825782 splice site probably null
R0738:Dscam UTSW 16 96819781 missense possibly damaging 0.48
R1017:Dscam UTSW 16 96833433 missense probably damaging 1.00
R1377:Dscam UTSW 16 96772494 missense probably damaging 1.00
R1440:Dscam UTSW 16 96819951 missense probably damaging 1.00
R1442:Dscam UTSW 16 96608074 missense possibly damaging 0.94
R1464:Dscam UTSW 16 96801253 missense possibly damaging 0.94
R1464:Dscam UTSW 16 96801253 missense possibly damaging 0.94
R1478:Dscam UTSW 16 96790910 missense probably benign 0.15
R1530:Dscam UTSW 16 96819874 missense probably damaging 1.00
R1731:Dscam UTSW 16 96819876 missense probably damaging 1.00
R1765:Dscam UTSW 16 96685379 missense probably benign 0.00
R1824:Dscam UTSW 16 96825581 missense probably benign 0.00
R1933:Dscam UTSW 16 96593214 missense probably benign 0.00
R2005:Dscam UTSW 16 97038920 missense probably benign 0.02
R2006:Dscam UTSW 16 96819912 missense probably damaging 1.00
R2101:Dscam UTSW 16 96610349 missense probably benign 0.00
R2177:Dscam UTSW 16 96610324 missense probably damaging 0.98
R2342:Dscam UTSW 16 96619502 missense probably damaging 1.00
R2851:Dscam UTSW 16 96622715 missense possibly damaging 0.94
R2929:Dscam UTSW 16 96685412 missense possibly damaging 0.76
R3055:Dscam UTSW 16 96801355 missense probably damaging 1.00
R3157:Dscam UTSW 16 96678510 missense probably benign 0.16
R3159:Dscam UTSW 16 96678510 missense probably benign 0.16
R3944:Dscam UTSW 16 96820997 missense probably damaging 0.99
R4080:Dscam UTSW 16 96683772 missense probably benign 0.01
R4285:Dscam UTSW 16 96709109 critical splice donor site probably null
R4384:Dscam UTSW 16 96709216 missense probably damaging 0.99
R4460:Dscam UTSW 16 96610319 missense probably damaging 1.00
R4594:Dscam UTSW 16 96717996 missense possibly damaging 0.78
R4643:Dscam UTSW 16 96685301 missense probably damaging 0.96
R4698:Dscam UTSW 16 96610324 missense probably damaging 1.00
R4716:Dscam UTSW 16 96619571 missense possibly damaging 0.80
R4743:Dscam UTSW 16 96830056 missense probably benign 0.00
R4766:Dscam UTSW 16 96643988 missense probably benign 0.02
R4899:Dscam UTSW 16 96683818 missense probably benign 0.01
R4987:Dscam UTSW 16 96697521 missense probably benign 0.00
R4990:Dscam UTSW 16 96825515 missense probably benign 0.12
R5123:Dscam UTSW 16 96772437 missense probably damaging 1.00
R5130:Dscam UTSW 16 96819779 missense probably benign 0.00
R5328:Dscam UTSW 16 96673678 missense probably benign 0.33
R5666:Dscam UTSW 16 96718164 missense probably benign 0.23
R5670:Dscam UTSW 16 96718164 missense probably benign 0.23
R5678:Dscam UTSW 16 96790900 missense probably benign 0.16
R5827:Dscam UTSW 16 96649991 critical splice donor site probably null
R5907:Dscam UTSW 16 96820920 missense probably damaging 0.97
R6032:Dscam UTSW 16 96649991 critical splice donor site probably null
R6032:Dscam UTSW 16 96649991 critical splice donor site probably null
R6103:Dscam UTSW 16 96825581 missense probably benign
R6240:Dscam UTSW 16 96619502 missense probably damaging 1.00
R6257:Dscam UTSW 16 96673714 missense possibly damaging 0.94
R6361:Dscam UTSW 16 96622811 missense probably benign 0.08
R6405:Dscam UTSW 16 96678425 missense probably damaging 1.00
R6444:Dscam UTSW 16 96619644 missense probably damaging 1.00
R6560:Dscam UTSW 16 96825735 missense probably benign 0.00
R6598:Dscam UTSW 16 96819784 missense probably damaging 1.00
R6622:Dscam UTSW 16 96645073 missense probably benign 0.06
R6792:Dscam UTSW 16 96593255 missense probably damaging 0.96
R6792:Dscam UTSW 16 96648237 missense probably damaging 1.00
R6827:Dscam UTSW 16 97038991 missense probably damaging 1.00
R6868:Dscam UTSW 16 96829940 missense probably damaging 1.00
R6898:Dscam UTSW 16 96829900 missense probably benign 0.02
R6903:Dscam UTSW 16 96820788 missense probably damaging 1.00
R7051:Dscam UTSW 16 96819786 missense probably benign 0.01
R7146:Dscam UTSW 16 96829917 nonsense probably null
R7180:Dscam UTSW 16 96825564 missense probably damaging 0.97
R7209:Dscam UTSW 16 96650344 intron probably null
R7247:Dscam UTSW 16 96820808 missense probably damaging 0.99
R7269:Dscam UTSW 16 96678401 missense probably benign 0.00
R7301:Dscam UTSW 16 97056532 missense probably benign 0.01
R7328:Dscam UTSW 16 96645035 nonsense probably null
R7368:Dscam UTSW 16 96643931 missense probably benign 0.00
R7425:Dscam UTSW 16 96629398 missense probably damaging 1.00
R7474:Dscam UTSW 16 96819889 missense possibly damaging 0.88
R7536:Dscam UTSW 16 96641026 intron probably null
R7624:Dscam UTSW 16 96610324 missense probably damaging 1.00
R7766:Dscam UTSW 16 96790901 missense probably benign 0.31
R7817:Dscam UTSW 16 96640864 missense probably benign
R7843:Dscam UTSW 16 96825630 missense probably damaging 0.99
R7911:Dscam UTSW 16 96643922 missense probably benign 0.01
R7926:Dscam UTSW 16 96825630 missense probably damaging 0.99
R7961:Dscam UTSW 16 96709421 intron probably null
R7992:Dscam UTSW 16 96643922 missense probably benign 0.01
X0025:Dscam UTSW 16 96709161 missense probably damaging 1.00
Z1088:Dscam UTSW 16 96772561 missense probably benign 0.01
Z1177:Dscam UTSW 16 96608189 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGAGTGACTCTGCATGGCTC -3'
(R):5'- CAACAGTGTCAATACCTTGTGG -3'

Sequencing Primer
(F):5'- ATCCCATGCTCCACTGGATTCTG -3'
(R):5'- AGTGTCAATACCTTGTGGTGTTTTAC -3'
Posted On2015-09-24