Mutagenetix > Incidental Mutation

Incidental Mutation 'R4576:Slco6b1'

342434

Institutional Source

Beutler Lab

Gene Symbol

Slco6b1

Ensembl Gene

ENSMUSG00000045463

Gene Name

solute carrier organic anion transporter family, member 6b1

Synonyms

1700022M03Rik

MMRRC Submission

041799-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.086) question?

Stock #

R4576 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

96906176-96997577 bp(-) (GRCm38)

Type of Mutation

exon

DNA Base Change (assembly)

T to A at 96988697 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s):

AlphaFold

no structure available at present

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000167383

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000178359

SMART Domains

Protein: ENSMUSP00000136663
Gene: ENSMUSG00000045463

Domain	Start	End	E-Value	Type
Pfam:MFS_1	103	481	1.6e-12	PFAM
Pfam:OATP	108	668	9.7e-128	PFAM
Pfam:Kazal_2	511	552	5.1e-8	PFAM
transmembrane domain	670	692	N/A	INTRINSIC

Meta Mutation Damage Score

0.0869

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

98% (84/86)

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6430531B16Rik	A	G	7: 139,978,130	I51T	probably damaging	Het
Adhfe1	A	T	1: 9,553,754	D160V	probably damaging	Het
AI314180	A	T	4: 58,834,708		probably benign	Het
Ano9	T	C	7: 141,104,138	Q538R	probably damaging	Het
Atp4a	A	G	7: 30,717,722	D510G	probably benign	Het
Atp8a1	T	C	5: 67,815,815		probably benign	Het
Auts2	C	T	5: 132,258,934	G70E	probably benign	Het
C7	A	G	15: 5,002,756	S658P	probably damaging	Het
Cdh9	T	C	15: 16,832,239	V404A	possibly damaging	Het
Cfap54	C	T	10: 93,043,228		probably null	Het
Chml	G	T	1: 175,686,940	Q129K	probably damaging	Het
Chst2	T	C	9: 95,405,171	H374R	probably damaging	Het
Cirbp	A	G	10: 80,170,241	K84E	probably damaging	Het
Cln6	G	T	9: 62,838,949	Q23H	probably benign	Het
Cntn5	A	G	9: 9,673,292	M801T	probably benign	Het
Dapk1	A	T	13: 60,721,822	M293L	probably benign	Het
Ddx11	A	G	17: 66,150,726	K869E	probably damaging	Het
Ddx17	A	T	15: 79,541,146	M108K	probably benign	Het
Dnaaf5	C	A	5: 139,185,639	A557D	probably damaging	Het
Edil3	T	C	13: 89,319,731	Y452H	probably damaging	Het
Elfn1	T	C	5: 139,972,053	S271P	probably benign	Het
Enah	G	A	1: 181,919,563	S298L	possibly damaging	Het
Exoc7	T	C	11: 116,289,183	*685W	probably null	Het
Fam166a	T	C	2: 25,220,288	S71P	probably benign	Het
Fgfbp1	C	T	5: 43,979,464	R162H	probably benign	Het
Foxj3	A	G	4: 119,621,663	S439G	unknown	Het
Fzd9	A	G	5: 135,250,312	S240P	probably damaging	Het
Gin1	A	G	1: 97,792,339	D442G	probably damaging	Het
Gm10804	C	T	2: 93,468,669		noncoding transcript	Het
Gm7102	C	T	19: 61,175,926	G24R	unknown	Het
Grhl3	G	T	4: 135,561,251	T41K	probably damaging	Het
H6pd	A	T	4: 149,994,476	D243E	probably damaging	Het
Heatr6	T	A	11: 83,765,000	S306T	probably benign	Het
Hkdc1	T	C	10: 62,385,843	D812G	possibly damaging	Het
Hmcn1	G	T	1: 150,734,487	T1477K	probably benign	Het
Ift80	A	G	3: 68,950,530	S261P	possibly damaging	Het
Kcnu1	A	T	8: 25,890,020	D424V	probably benign	Het
Kctd1	A	G	18: 15,007,700	S658P	probably damaging	Het
Klk12	A	G	7: 43,773,243	D198G	probably damaging	Het
Kntc1	T	G	5: 123,765,955	L345R	probably damaging	Het
Llph-ps2	A	G	X: 13,218,451		noncoding transcript	Het
Lpxn	T	C	19: 12,833,290	I366T	probably benign	Het
Lrp1	ACAGGCGC	AC	10: 127,540,188		probably benign	Het
Maml3	G	A	3: 51,856,506	Q346*	probably null	Het
Mef2a	T	C	7: 67,240,439	N131S	probably benign	Het
Mlc1	G	A	15: 88,974,537	T136M	probably damaging	Het
Pcdhga9	A	C	18: 37,737,828	N237H	probably damaging	Het
Pde4dip	C	A	3: 97,754,249	E657D	probably damaging	Het
Pknox2	A	G	9: 36,923,548		probably benign	Het
Plcb3	C	T	19: 6,959,047		probably benign	Het
Plxnd1	G	A	6: 115,968,044	A99V	probably benign	Het
Pnpla2	T	C	7: 141,457,344	S87P	probably damaging	Het
Ppp1r14c	G	T	10: 3,366,912	K82N	probably damaging	Het
Pum3	G	A	19: 27,415,908	T389M	probably benign	Het
Pxdn	A	T	12: 30,011,923	T1165S	probably benign	Het
Rasgrf2	T	C	13: 91,896,410	D925G	possibly damaging	Het
Samhd1	A	T	2: 157,101,750	C615S	probably damaging	Het
Sec16a	A	T	2: 26,431,119	Y1320*	probably null	Het
Slitrk6	C	A	14: 110,750,170	V702F	probably benign	Het
Spata31d1b	C	A	13: 59,716,861	H608N	probably damaging	Het
Srpr	T	C	9: 35,214,608	I394T	possibly damaging	Het
Svop	C	T	5: 114,065,682	V13M	probably damaging	Het
Tacc3	T	A	5: 33,661,497		probably benign	Het
Tango2	A	T	16: 18,301,528	D146E	probably damaging	Het
Thbs1	G	A	2: 118,119,416	R624Q	probably damaging	Het
Tmem161a	T	C	8: 70,182,063		probably null	Het
Tmem175	A	G	5: 108,644,602	D248G	possibly damaging	Het
Traf3ip2	A	G	10: 39,634,654	N308D	probably damaging	Het
Trim30b	T	C	7: 104,357,331	Y106C	possibly damaging	Het
Trip11	G	A	12: 101,886,240	Q521*	probably null	Het
Tssk5	C	T	15: 76,372,468	R280Q	probably benign	Het
Ttc16	A	T	2: 32,770,059	F246I	probably benign	Het
Unc79	T	C	12: 103,001,803		probably benign	Het
Vmn1r74	A	G	7: 11,846,769		probably null	Het
Vmn2r16	A	T	5: 109,363,799	Y624F	possibly damaging	Het
Zc3h4	G	A	7: 16,434,654	R896H	unknown	Het
Zfp941	T	A	7: 140,811,590	K619*	probably null	Het
Zfp970	A	T	2: 177,475,680	H349L	probably damaging	Het

Other mutations in Slco6b1

Allele	Source	Chr	Coord	Type	Predicted Effect
IGL00434:Slco6b1	APN	1	96988650	exon	noncoding transcript
IGL02110:Slco6b1	APN	1	96987882	exon	noncoding transcript
IGL02416:Slco6b1	APN	1	96924333	exon	noncoding transcript
IGL03406:Slco6b1	APN	1	96947585	exon	noncoding transcript
R0147:Slco6b1	UTSW	1	96987837	exon	noncoding transcript
R0277:Slco6b1	UTSW	1	96988673	exon	noncoding transcript
R0513:Slco6b1	UTSW	1	96997184	unclassified	noncoding transcript
R1401:Slco6b1	UTSW	1	96929885	splice site	noncoding transcript
R1823:Slco6b1	UTSW	1	96961176	exon	noncoding transcript
R1888:Slco6b1	UTSW	1	96922061	splice site	noncoding transcript
R4125:Slco6b1	UTSW	1	96987897	exon	noncoding transcript
R4281:Slco6b1	UTSW	1	96997390	unclassified	noncoding transcript
R4282:Slco6b1	UTSW	1	96997390	unclassified	noncoding transcript
R4850:Slco6b1	UTSW	1	96911833	unclassified	noncoding transcript
R5222:Slco6b1	UTSW	1	96997491	unclassified	noncoding transcript
R5389:Slco6b1	UTSW	1	96988584	exon	noncoding transcript
R5801:Slco6b1	UTSW	1	96947631	exon	noncoding transcript

Predicted Primers

PCR Primer
(F):5'- GGGCCGACACTATTTCTGTG -3'
(R):5'- GCATACCTGTGTAGATGTAATCTTG -3'

Sequencing Primer
(F):5'- TCCAAGGAATATTCAAAATGGGCC -3'
(R):5'- CTGACACATTTTCTTTTACTGTGC -3'

Posted On

2015-09-24