Mutagenetix > Incidental Mutation

Incidental Mutation 'R0346:Itgav'

34244

Institutional Source

Beutler Lab

Gene Symbol

Itgav

Ensembl Gene

ENSMUSG00000027087

Gene Name

integrin alpha V

Synonyms

alphav-integrin, CD51, 1110004F14Rik, 2610028E01Rik, vitronectin receptor alpha polypeptide (VNRA), D430040G12Rik

MMRRC Submission

038553-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0346 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

83724397-83806916 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 83792609 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Phenylalanine at position 675 (C675F)

Ref Sequence

ENSEMBL: ENSMUSP00000107369 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028499] [ENSMUST00000111740]

AlphaFold

P43406

Predicted Effect

probably damaging
Transcript: ENSMUST00000028499
AA Change: C711F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000028499
Gene: ENSMUSG00000027087
AA Change: C711F

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
Int_alpha	45	104	1.05e-3	SMART
Int_alpha	248	298	4.9e-13	SMART
Int_alpha	302	363	4.55e-8	SMART
Int_alpha	366	422	2.2e-15	SMART
Int_alpha	430	484	1.62e-4	SMART
SCOP:d1m1xa2	629	767	3e-49	SMART
SCOP:d1m1xa3	768	982	1e-89	SMART
low complexity region	995	1008	N/A	INTRINSIC
Pfam:Integrin_alpha	1013	1027	3.9e-7	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000111740
AA Change: C675F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000107369
Gene: ENSMUSG00000027087
AA Change: C675F

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
Int_alpha	45	104	1.05e-3	SMART
Int_alpha	212	262	4.9e-13	SMART
Int_alpha	266	327	4.55e-8	SMART
Int_alpha	330	386	2.2e-15	SMART
Int_alpha	394	448	1.62e-4	SMART
SCOP:d1m1xa2	593	731	5e-49	SMART
SCOP:d1m1xa3	732	946	2e-89	SMART
low complexity region	959	972	N/A	INTRINSIC
Pfam:Integrin_alpha	977	991	1.3e-7	PFAM

Meta Mutation Damage Score

0.9730

Coding Region Coverage

1x: 99.5%
3x: 98.9%
10x: 97.7%
20x: 96.4%

Validation Efficiency

100% (79/79)

MGI Phenotype

FUNCTION: This gene encodes a protein that is a member of the integrin superfamily. Integrins are transmembrane receptors involved cell adhesion and signaling, and they are subdivided based on the heterodimer formation of alpha and beta chains. This protein has been shown to heterodimerize with beta 1, beta 3, beta 6 and beta 8. The heterodimer of alpha v and beta 3 forms the Vitronectin receptor. This protein interacts with several extracellular matrix proteins to mediate cell adhesion and may play a role in cell migration. In mouse, deficiency of this gene is associated with defects in vascular morphogenesis in the brain and early post-natal death. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit placental defects, intracerebral and intestinal hemorrhages, and cleft palate, resulting in death occurring as early as midgestation and as late as shortly after birth. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	A	T	11: 9,566,278	I4406L	probably damaging	Het
Abca16	T	A	7: 120,435,932	C314S	probably damaging	Het
Add3	C	T	19: 53,216,956	R46*	probably null	Het
Alas1	A	T	9: 106,243,351	S82T	possibly damaging	Het
Alkbh5	C	G	11: 60,538,741	R107G	possibly damaging	Het
Ap3b1	A	T	13: 94,445,971	R365*	probably null	Het
Ass1	A	T	2: 31,514,819	N371Y	probably damaging	Het
AU021092	T	C	16: 5,216,854	D168G	possibly damaging	Het
Bcl2	G	A	1: 106,712,562	R107C	probably damaging	Het
Caln1	C	A	5: 130,822,921	H184N	possibly damaging	Het
Camta1	C	A	4: 151,075,140	R1614L	probably damaging	Het
Ccdc191	T	C	16: 43,938,952	V372A	probably damaging	Het
Ccng2	T	G	5: 93,270,894	I126S	probably damaging	Het
Cep85	A	T	4: 134,132,422	N643K	probably damaging	Het
Clvs2	G	C	10: 33,622,546	S129R	possibly damaging	Het
Cntn1	G	T	15: 92,232,087		probably benign	Het
Cttn	A	T	7: 144,452,539		probably benign	Het
Dedd2	T	C	7: 25,211,269	S161G	possibly damaging	Het
Dnajb13	T	C	7: 100,503,925	D263G	probably damaging	Het
Dppa4	T	A	16: 48,289,324		probably benign	Het
Ear2	A	G	14: 44,102,906	E7G	probably damaging	Het
Eif2b4	A	G	5: 31,188,108		probably benign	Het
Etl4	G	T	2: 20,759,652		probably null	Het
Fbxo15	T	A	18: 84,960,221		probably null	Het
Gm8765	T	C	13: 50,703,310	Y995H	probably benign	Het
Gm9970	A	G	5: 31,240,838		probably benign	Het
Hap1	A	G	11: 100,356,029	S17P	probably benign	Het
Hgd	C	T	16: 37,588,774		probably benign	Het
Inpp5f	T	A	7: 128,690,668	L16Q	probably damaging	Het
Islr2	G	A	9: 58,198,343	R545*	probably null	Het
Kif13a	T	A	13: 46,814,219	I403L	possibly damaging	Het
Kif14	T	A	1: 136,468,160	I68N	probably damaging	Het
Kif26a	G	T	12: 112,179,348	K1764N	probably null	Het
Lrrd1	C	A	5: 3,850,215	F173L	probably benign	Het
Mroh4	G	C	15: 74,614,292		probably benign	Het
Mrvi1	T	C	7: 110,898,976	D404G	probably damaging	Het
Msh5	A	G	17: 35,029,888	V723A	probably benign	Het
Mybph	T	G	1: 134,197,754	I279S	probably damaging	Het
Myh4	A	T	11: 67,260,326	I1936L	probably benign	Het
Myo1h	A	T	5: 114,355,209	T704S	probably benign	Het
Nav2	C	A	7: 49,604,585	T2377K	probably benign	Het
Nipbl	T	G	15: 8,360,956	Q276H	probably damaging	Het
Nlrp9b	T	C	7: 20,024,515	L559P	probably damaging	Het
Nup210l	T	A	3: 90,189,438	V1318E	probably damaging	Het
Olfr1427	A	T	19: 12,099,439	S67T	probably damaging	Het
Olfr18	A	G	9: 20,314,411	S170P	probably benign	Het
Olfr385	A	G	11: 73,589,457	Y94H	probably damaging	Het
Olfr765	C	A	10: 129,046,473	V197F	possibly damaging	Het
P2ry13	T	C	3: 59,209,566	T264A	possibly damaging	Het
Plekhg5	T	C	4: 152,114,253	L966P	probably benign	Het
Prss35	A	G	9: 86,755,351	K58R	probably benign	Het
Ptafr	T	A	4: 132,580,079	L260*	probably null	Het
Pum1	A	T	4: 130,779,805	T1157S	possibly damaging	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
Rnf145	A	G	11: 44,555,164	Y275C	probably damaging	Het
Rpl6	A	T	5: 121,208,491	K218N	possibly damaging	Het
Rps6	T	C	4: 86,855,981	T128A	probably benign	Het
Ryr1	G	T	7: 29,067,588		probably benign	Het
Scel	A	T	14: 103,529,984	Q26H	probably damaging	Het
Sfxn4	A	T	19: 60,858,673	D57E	probably benign	Het
Slc35d1	A	C	4: 103,190,847	L240R	probably damaging	Het
Smcr8	A	G	11: 60,779,750	I575V	probably benign	Het
Syk	G	A	13: 52,640,659	M476I	probably damaging	Het
Tbcel	A	T	9: 42,437,243		probably benign	Het
Tob2	C	A	15: 81,858,223	G65W	probably damaging	Het
Trim16	A	G	11: 62,840,694	N464D	probably benign	Het
Trim36	T	C	18: 46,199,709		probably benign	Het
Trpv4	C	A	5: 114,630,529		probably benign	Het
Tsga10	T	A	1: 37,840,519	T64S	possibly damaging	Het
Ttc26	T	C	6: 38,409,435	C364R	probably damaging	Het
Vars2	A	T	17: 35,664,864		probably benign	Het
Vmn1r72	C	A	7: 11,669,694	V276L	probably benign	Het
Vps13a	T	A	19: 16,677,969	K1898N	probably benign	Het
Vps18	A	G	2: 119,297,164	M823V	probably damaging	Het
Washc2	T	C	6: 116,220,523		probably benign	Het
Zfp763	A	T	17: 33,019,747	H141Q	probably benign	Het

Other mutations in Itgav

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00499:Itgav	APN	2	83802995	missense	probably damaging	1.00
IGL01969:Itgav	APN	2	83803283	missense	probably damaging	1.00
IGL02371:Itgav	APN	2	83770053	missense	probably damaging	1.00
IGL02563:Itgav	APN	2	83771236	missense	probably benign
IGL02640:Itgav	APN	2	83791939	missense	probably benign	0.33
IGL02641:Itgav	APN	2	83768345	splice site	probably benign
IGL02927:Itgav	APN	2	83795540	missense	probably damaging	1.00
IGL03172:Itgav	APN	2	83765846	missense	possibly damaging	0.51
R0158:Itgav	UTSW	2	83792037	missense	probably benign	0.33
R0508:Itgav	UTSW	2	83792658	splice site	probably benign
R0546:Itgav	UTSW	2	83803242	missense	probably benign	0.04
R0554:Itgav	UTSW	2	83794270	missense	possibly damaging	0.95
R1122:Itgav	UTSW	2	83791939	missense	probably benign	0.33
R1468:Itgav	UTSW	2	83765901	splice site	probably benign
R1566:Itgav	UTSW	2	83736630	missense	probably damaging	1.00
R1657:Itgav	UTSW	2	83801779	missense	probably benign	0.21
R1892:Itgav	UTSW	2	83771336	missense	probably damaging	1.00
R1912:Itgav	UTSW	2	83795486	missense	possibly damaging	0.85
R2176:Itgav	UTSW	2	83803255	missense	probably damaging	1.00
R2438:Itgav	UTSW	2	83776542	missense	probably damaging	1.00
R2449:Itgav	UTSW	2	83768750	critical splice donor site	probably null
R3110:Itgav	UTSW	2	83792571	nonsense	probably null
R3112:Itgav	UTSW	2	83792571	nonsense	probably null
R3176:Itgav	UTSW	2	83776542	missense	probably damaging	1.00
R3177:Itgav	UTSW	2	83776542	missense	probably damaging	1.00
R3276:Itgav	UTSW	2	83776542	missense	probably damaging	1.00
R3277:Itgav	UTSW	2	83776542	missense	probably damaging	1.00
R3766:Itgav	UTSW	2	83801885	critical splice donor site	probably null
R3774:Itgav	UTSW	2	83791964	missense	probably damaging	1.00
R3880:Itgav	UTSW	2	83768301	missense	probably damaging	1.00
R4196:Itgav	UTSW	2	83768327	missense	probably benign	0.24
R4287:Itgav	UTSW	2	83724840	nonsense	probably null
R4620:Itgav	UTSW	2	83755902	missense	probably benign	0.07
R4790:Itgav	UTSW	2	83755810	missense	probably damaging	1.00
R4946:Itgav	UTSW	2	83788983	missense	probably benign	0.16
R6150:Itgav	UTSW	2	83776436	missense	probably benign
R6345:Itgav	UTSW	2	83802036	missense	probably damaging	1.00
R6482:Itgav	UTSW	2	83794270	missense	probably damaging	1.00
R6900:Itgav	UTSW	2	83803247	missense	probably damaging	1.00
R7247:Itgav	UTSW	2	83724835	missense	probably damaging	0.98
R7317:Itgav	UTSW	2	83794983	missense	probably benign	0.12
R7429:Itgav	UTSW	2	83794258	missense	probably damaging	1.00
R7430:Itgav	UTSW	2	83794258	missense	probably damaging	1.00
R7522:Itgav	UTSW	2	83802029	missense	probably benign	0.10
R7546:Itgav	UTSW	2	83776550	nonsense	probably null
R7578:Itgav	UTSW	2	83747875	missense	probably benign	0.16
R8311:Itgav	UTSW	2	83765777	missense	probably damaging	1.00
R8497:Itgav	UTSW	2	83785461	missense	probably damaging	1.00
R8744:Itgav	UTSW	2	83770083	missense	probably benign	0.25
R9752:Itgav	UTSW	2	83770107	critical splice donor site	probably null
V1662:Itgav	UTSW	2	83783854	missense	possibly damaging	0.91

Predicted Primers

PCR Primer
(F):5'- TTACATGCAGCAGTGGTCCACAG -3'
(R):5'- AGCGGTAGGGCATTTTCCAAGC -3'

Sequencing Primer
(F):5'- GTCCACAGCCCCGACTTC -3'
(R):5'- ATGTGCAAGGTCCTGGC -3'

Posted On

2013-05-09