Incidental Mutation 'R4576:AI314180'
ID342449
Institutional Source Beutler Lab
Gene Symbol AI314180
Ensembl Gene ENSMUSG00000050812
Gene Nameexpressed sequence AI314180
Synonyms
MMRRC Submission 041799-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.371) question?
Stock #R4576 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location58798911-58912749 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to T at 58834708 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000117585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102889] [ENSMUST00000107557] [ENSMUST00000149301]
Predicted Effect probably benign
Transcript: ENSMUST00000102889
SMART Domains Protein: ENSMUSP00000099953
Gene: ENSMUSG00000050812

DomainStartEndE-ValueType
Pfam:Ecm29 10 517 1.1e-155 PFAM
low complexity region 627 642 N/A INTRINSIC
low complexity region 653 665 N/A INTRINSIC
SCOP:d1qbkb_ 693 1491 3e-31 SMART
low complexity region 1781 1797 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107557
SMART Domains Protein: ENSMUSP00000103182
Gene: ENSMUSG00000050812

DomainStartEndE-ValueType
Pfam:Ecm29 10 517 7.6e-164 PFAM
low complexity region 627 642 N/A INTRINSIC
low complexity region 653 665 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135601
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142102
Predicted Effect probably benign
Transcript: ENSMUST00000149301
SMART Domains Protein: ENSMUSP00000117585
Gene: ENSMUSG00000050812

DomainStartEndE-ValueType
Pfam:Ecm29 10 517 4e-163 PFAM
low complexity region 627 642 N/A INTRINSIC
low complexity region 653 665 N/A INTRINSIC
SCOP:d1qbkb_ 693 1490 8e-32 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151869
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (84/86)
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430531B16Rik A G 7: 139,978,130 I51T probably damaging Het
Adhfe1 A T 1: 9,553,754 D160V probably damaging Het
Ano9 T C 7: 141,104,138 Q538R probably damaging Het
Atp4a A G 7: 30,717,722 D510G probably benign Het
Atp8a1 T C 5: 67,815,815 probably benign Het
Auts2 C T 5: 132,258,934 G70E probably benign Het
C7 A G 15: 5,002,756 S658P probably damaging Het
Cdh9 T C 15: 16,832,239 V404A possibly damaging Het
Cfap54 C T 10: 93,043,228 probably null Het
Chml G T 1: 175,686,940 Q129K probably damaging Het
Chst2 T C 9: 95,405,171 H374R probably damaging Het
Cirbp A G 10: 80,170,241 K84E probably damaging Het
Cln6 G T 9: 62,838,949 Q23H probably benign Het
Cntn5 A G 9: 9,673,292 M801T probably benign Het
Dapk1 A T 13: 60,721,822 M293L probably benign Het
Ddx11 A G 17: 66,150,726 K869E probably damaging Het
Ddx17 A T 15: 79,541,146 M108K probably benign Het
Dnaaf5 C A 5: 139,185,639 A557D probably damaging Het
Edil3 T C 13: 89,319,731 Y452H probably damaging Het
Elfn1 T C 5: 139,972,053 S271P probably benign Het
Enah G A 1: 181,919,563 S298L possibly damaging Het
Exoc7 T C 11: 116,289,183 *685W probably null Het
Fam166a T C 2: 25,220,288 S71P probably benign Het
Fgfbp1 C T 5: 43,979,464 R162H probably benign Het
Foxj3 A G 4: 119,621,663 S439G unknown Het
Fzd9 A G 5: 135,250,312 S240P probably damaging Het
Gin1 A G 1: 97,792,339 D442G probably damaging Het
Gm10804 C T 2: 93,468,669 noncoding transcript Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Grhl3 G T 4: 135,561,251 T41K probably damaging Het
H6pd A T 4: 149,994,476 D243E probably damaging Het
Heatr6 T A 11: 83,765,000 S306T probably benign Het
Hkdc1 T C 10: 62,385,843 D812G possibly damaging Het
Hmcn1 G T 1: 150,734,487 T1477K probably benign Het
Ift80 A G 3: 68,950,530 S261P possibly damaging Het
Kcnu1 A T 8: 25,890,020 D424V probably benign Het
Kctd1 A G 18: 15,007,700 S658P probably damaging Het
Klk12 A G 7: 43,773,243 D198G probably damaging Het
Kntc1 T G 5: 123,765,955 L345R probably damaging Het
Llph-ps2 A G X: 13,218,451 noncoding transcript Het
Lpxn T C 19: 12,833,290 I366T probably benign Het
Lrp1 ACAGGCGC AC 10: 127,540,188 probably benign Het
Maml3 G A 3: 51,856,506 Q346* probably null Het
Mef2a T C 7: 67,240,439 N131S probably benign Het
Mlc1 G A 15: 88,974,537 T136M probably damaging Het
Pcdhga9 A C 18: 37,737,828 N237H probably damaging Het
Pde4dip C A 3: 97,754,249 E657D probably damaging Het
Pknox2 A G 9: 36,923,548 probably benign Het
Plcb3 C T 19: 6,959,047 probably benign Het
Plxnd1 G A 6: 115,968,044 A99V probably benign Het
Pnpla2 T C 7: 141,457,344 S87P probably damaging Het
Ppp1r14c G T 10: 3,366,912 K82N probably damaging Het
Pum3 G A 19: 27,415,908 T389M probably benign Het
Pxdn A T 12: 30,011,923 T1165S probably benign Het
Rasgrf2 T C 13: 91,896,410 D925G possibly damaging Het
Samhd1 A T 2: 157,101,750 C615S probably damaging Het
Sec16a A T 2: 26,431,119 Y1320* probably null Het
Slco6b1 T A 1: 96,988,697 noncoding transcript Het
Slitrk6 C A 14: 110,750,170 V702F probably benign Het
Spata31d1b C A 13: 59,716,861 H608N probably damaging Het
Srpr T C 9: 35,214,608 I394T possibly damaging Het
Svop C T 5: 114,065,682 V13M probably damaging Het
Tacc3 T A 5: 33,661,497 probably benign Het
Tango2 A T 16: 18,301,528 D146E probably damaging Het
Thbs1 G A 2: 118,119,416 R624Q probably damaging Het
Tmem161a T C 8: 70,182,063 probably null Het
Tmem175 A G 5: 108,644,602 D248G possibly damaging Het
Traf3ip2 A G 10: 39,634,654 N308D probably damaging Het
Trim30b T C 7: 104,357,331 Y106C possibly damaging Het
Trip11 G A 12: 101,886,240 Q521* probably null Het
Tssk5 C T 15: 76,372,468 R280Q probably benign Het
Ttc16 A T 2: 32,770,059 F246I probably benign Het
Unc79 T C 12: 103,001,803 probably benign Het
Vmn1r74 A G 7: 11,846,769 probably null Het
Vmn2r16 A T 5: 109,363,799 Y624F possibly damaging Het
Zc3h4 G A 7: 16,434,654 R896H unknown Het
Zfp941 T A 7: 140,811,590 K619* probably null Het
Zfp970 A T 2: 177,475,680 H349L probably damaging Het
Other mutations in AI314180
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00799:AI314180 APN 4 58828047 missense possibly damaging 0.95
IGL01145:AI314180 APN 4 58811501 missense probably null 0.08
IGL01371:AI314180 APN 4 58809718 missense probably damaging 1.00
IGL01445:AI314180 APN 4 58833988 missense probably benign 0.08
IGL01452:AI314180 APN 4 58836181 missense probably damaging 0.99
IGL01626:AI314180 APN 4 58832814 splice site probably benign
IGL01672:AI314180 APN 4 58814041 missense probably benign 0.40
IGL01943:AI314180 APN 4 58849937 missense possibly damaging 0.91
IGL01944:AI314180 APN 4 58861544 missense probably benign 0.42
IGL02190:AI314180 APN 4 58800190 missense probably benign 0.12
IGL02272:AI314180 APN 4 58811731 missense probably benign 0.00
IGL02435:AI314180 APN 4 58830325 splice site probably benign
IGL02516:AI314180 APN 4 58877102 missense probably damaging 1.00
IGL02540:AI314180 APN 4 58805534 splice site probably benign
IGL02709:AI314180 APN 4 58872699 missense possibly damaging 0.90
IGL02742:AI314180 APN 4 58840757 missense probably damaging 0.96
IGL02812:AI314180 APN 4 58864343 splice site probably benign
IGL02828:AI314180 APN 4 58875512 missense possibly damaging 0.59
IGL03130:AI314180 APN 4 58800288 missense probably benign
IGL03179:AI314180 APN 4 58832777 missense probably damaging 1.00
IGL03237:AI314180 APN 4 58810668 missense probably benign 0.40
IGL03344:AI314180 APN 4 58828538 missense probably damaging 1.00
BB006:AI314180 UTSW 4 58869554 missense probably damaging 1.00
BB016:AI314180 UTSW 4 58869554 missense probably damaging 1.00
R0051:AI314180 UTSW 4 58832729 missense probably damaging 1.00
R0051:AI314180 UTSW 4 58832729 missense probably damaging 1.00
R0313:AI314180 UTSW 4 58811892 missense probably benign 0.11
R0399:AI314180 UTSW 4 58827047 missense possibly damaging 0.69
R0487:AI314180 UTSW 4 58819155 missense probably damaging 1.00
R0492:AI314180 UTSW 4 58864418 missense probably damaging 1.00
R0705:AI314180 UTSW 4 58885366 critical splice donor site probably null
R0847:AI314180 UTSW 4 58841439 missense probably benign 0.14
R1467:AI314180 UTSW 4 58832753 missense probably benign
R1467:AI314180 UTSW 4 58832753 missense probably benign
R1482:AI314180 UTSW 4 58820163 missense possibly damaging 0.85
R1529:AI314180 UTSW 4 58832701 splice site probably null
R1771:AI314180 UTSW 4 58879100 missense probably damaging 1.00
R1776:AI314180 UTSW 4 58879100 missense probably damaging 1.00
R1822:AI314180 UTSW 4 58805539 critical splice donor site probably null
R1864:AI314180 UTSW 4 58849942 missense possibly damaging 0.62
R2029:AI314180 UTSW 4 58844165 nonsense probably null
R2061:AI314180 UTSW 4 58824270 missense probably damaging 1.00
R2125:AI314180 UTSW 4 58833978 missense probably benign
R2266:AI314180 UTSW 4 58830332 critical splice donor site probably null
R2889:AI314180 UTSW 4 58836165 missense probably benign
R2902:AI314180 UTSW 4 58809691 missense probably benign 0.31
R2903:AI314180 UTSW 4 58828622 missense possibly damaging 0.50
R2925:AI314180 UTSW 4 58833928 nonsense probably null
R4151:AI314180 UTSW 4 58836254 missense possibly damaging 0.51
R4225:AI314180 UTSW 4 58847027 missense probably damaging 1.00
R4486:AI314180 UTSW 4 58820086 intron probably benign
R4580:AI314180 UTSW 4 58840751 missense probably damaging 1.00
R4654:AI314180 UTSW 4 58834523 missense possibly damaging 0.86
R4688:AI314180 UTSW 4 58840757 missense probably damaging 0.96
R4726:AI314180 UTSW 4 58844191 missense probably damaging 1.00
R4825:AI314180 UTSW 4 58850911 missense probably damaging 0.99
R4928:AI314180 UTSW 4 58827073 missense probably damaging 1.00
R5098:AI314180 UTSW 4 58877048 missense probably damaging 1.00
R5284:AI314180 UTSW 4 58836172 missense possibly damaging 0.90
R5375:AI314180 UTSW 4 58809401 nonsense probably null
R5382:AI314180 UTSW 4 58850934 missense probably benign 0.38
R5487:AI314180 UTSW 4 58809421 missense probably benign 0.22
R5703:AI314180 UTSW 4 58877171 splice site probably null
R5761:AI314180 UTSW 4 58853131 missense probably damaging 1.00
R5791:AI314180 UTSW 4 58814027 missense possibly damaging 0.90
R5791:AI314180 UTSW 4 58822111 missense probably damaging 1.00
R5928:AI314180 UTSW 4 58849948 missense possibly damaging 0.59
R6062:AI314180 UTSW 4 58826453 missense possibly damaging 0.84
R6246:AI314180 UTSW 4 58811365 splice site probably null
R6298:AI314180 UTSW 4 58877157 missense probably damaging 1.00
R6326:AI314180 UTSW 4 58827068 missense probably benign 0.34
R6478:AI314180 UTSW 4 58810785 missense probably damaging 1.00
R6707:AI314180 UTSW 4 58879101 missense possibly damaging 0.52
R6846:AI314180 UTSW 4 58814081 missense possibly damaging 0.85
R6857:AI314180 UTSW 4 58814065 missense probably damaging 1.00
R6951:AI314180 UTSW 4 58853114 critical splice donor site probably null
R7088:AI314180 UTSW 4 58849766 missense possibly damaging 0.93
R7302:AI314180 UTSW 4 58834593 missense probably benign 0.43
R7337:AI314180 UTSW 4 58827047 missense possibly damaging 0.69
R7341:AI314180 UTSW 4 58809415 missense possibly damaging 0.94
R7344:AI314180 UTSW 4 58824770 missense probably benign 0.08
R7525:AI314180 UTSW 4 58847038 missense possibly damaging 0.84
R7530:AI314180 UTSW 4 58815317 missense probably damaging 0.99
R7533:AI314180 UTSW 4 58809411 missense probably benign 0.12
R7557:AI314180 UTSW 4 58849691 missense possibly damaging 0.85
R7698:AI314180 UTSW 4 58832660 missense unknown
R7793:AI314180 UTSW 4 58853150 missense probably damaging 1.00
R7892:AI314180 UTSW 4 58828593 missense probably benign
R7894:AI314180 UTSW 4 58853708 missense probably damaging 1.00
R7929:AI314180 UTSW 4 58869554 missense probably damaging 1.00
R8010:AI314180 UTSW 4 58832681 missense unknown
R8082:AI314180 UTSW 4 58807852 missense probably benign 0.00
R8175:AI314180 UTSW 4 58872756 missense probably damaging 1.00
R8191:AI314180 UTSW 4 58872587 critical splice donor site probably null
X0060:AI314180 UTSW 4 58840752 missense possibly damaging 0.73
Z1177:AI314180 UTSW 4 58861614 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACACTGACCTATTGTTTCTGTAGC -3'
(R):5'- ACTCTGGATGTCAGTAAAGATTCAGC -3'

Sequencing Primer
(F):5'- GTAGCACTCCGAATGATCTCC -3'
(R):5'- GATTCAGCTTAATTTCTCAGCATTC -3'
Posted On2015-09-24