Mutagenetix > Incidental Mutation

Incidental Mutation 'R0346:Vps18'

34245

Institutional Source

Beutler Lab

Gene Symbol

Vps18

Ensembl Gene

ENSMUSG00000034216

Gene Name

VPS18 CORVET/HOPS core subunit

Synonyms

MMRRC Submission

038553-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0346 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

119288740-119298453 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 119297164 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Valine at position 823 (M823V)

Ref Sequence

ENSEMBL: ENSMUSP00000036915 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037280]

AlphaFold

Q8R307

Predicted Effect

probably damaging
Transcript: ENSMUST00000037280
AA Change: M823V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000036915
Gene: ENSMUSG00000034216
AA Change: M823V

Domain	Start	End	E-Value	Type
Pfam:Pep3_Vps18	291	435	2.4e-41	PFAM
low complexity region	486	500	N/A	INTRINSIC
Pfam:Clathrin	619	771	5.9e-11	PFAM
coiled coil region	803	845	N/A	INTRINSIC
Blast:RING	853	947	3e-47	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139367

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151500

Meta Mutation Damage Score

0.2766

Coding Region Coverage

1x: 99.5%
3x: 98.9%
10x: 97.7%
20x: 96.4%

Validation Efficiency

100% (79/79)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Vesicle mediated protein sorting plays an important role in segregation of intracellular molecules into distinct organelles. Genetic studies in yeast have identified more than 40 vacuolar protein sorting (VPS) genes involved in vesicle transport to vacuoles. This gene encodes the human homolog of yeast class C Vps18 protein. The mammalian class C Vps proteins are predominantly associated with late endosomes/lysosomes, and like their yeast counterparts, may mediate vesicle trafficking steps in the endosome/lysosome pathway. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a reporter allele exhibit preweaning lethality. Mice homozygous for a conditional allele activated in the nervous system exhibit impaired neuron migration and neurodegeneration associated with increased apoptosis and impaired autophagy and endocytosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	A	T	11: 9,566,278	I4406L	probably damaging	Het
Abca16	T	A	7: 120,435,932	C314S	probably damaging	Het
Add3	C	T	19: 53,216,956	R46*	probably null	Het
Alas1	A	T	9: 106,243,351	S82T	possibly damaging	Het
Alkbh5	C	G	11: 60,538,741	R107G	possibly damaging	Het
Ap3b1	A	T	13: 94,445,971	R365*	probably null	Het
Ass1	A	T	2: 31,514,819	N371Y	probably damaging	Het
AU021092	T	C	16: 5,216,854	D168G	possibly damaging	Het
Bcl2	G	A	1: 106,712,562	R107C	probably damaging	Het
Caln1	C	A	5: 130,822,921	H184N	possibly damaging	Het
Camta1	C	A	4: 151,075,140	R1614L	probably damaging	Het
Ccdc191	T	C	16: 43,938,952	V372A	probably damaging	Het
Ccng2	T	G	5: 93,270,894	I126S	probably damaging	Het
Cep85	A	T	4: 134,132,422	N643K	probably damaging	Het
Clvs2	G	C	10: 33,622,546	S129R	possibly damaging	Het
Cntn1	G	T	15: 92,232,087		probably benign	Het
Cttn	A	T	7: 144,452,539		probably benign	Het
Dedd2	T	C	7: 25,211,269	S161G	possibly damaging	Het
Dnajb13	T	C	7: 100,503,925	D263G	probably damaging	Het
Dppa4	T	A	16: 48,289,324		probably benign	Het
Ear2	A	G	14: 44,102,906	E7G	probably damaging	Het
Eif2b4	A	G	5: 31,188,108		probably benign	Het
Etl4	G	T	2: 20,759,652		probably null	Het
Fbxo15	T	A	18: 84,960,221		probably null	Het
Gm8765	T	C	13: 50,703,310	Y995H	probably benign	Het
Gm9970	A	G	5: 31,240,838		probably benign	Het
Hap1	A	G	11: 100,356,029	S17P	probably benign	Het
Hgd	C	T	16: 37,588,774		probably benign	Het
Inpp5f	T	A	7: 128,690,668	L16Q	probably damaging	Het
Islr2	G	A	9: 58,198,343	R545*	probably null	Het
Itgav	G	T	2: 83,792,609	C675F	probably damaging	Het
Kif13a	T	A	13: 46,814,219	I403L	possibly damaging	Het
Kif14	T	A	1: 136,468,160	I68N	probably damaging	Het
Kif26a	G	T	12: 112,179,348	K1764N	probably null	Het
Lrrd1	C	A	5: 3,850,215	F173L	probably benign	Het
Mroh4	G	C	15: 74,614,292		probably benign	Het
Mrvi1	T	C	7: 110,898,976	D404G	probably damaging	Het
Msh5	A	G	17: 35,029,888	V723A	probably benign	Het
Mybph	T	G	1: 134,197,754	I279S	probably damaging	Het
Myh4	A	T	11: 67,260,326	I1936L	probably benign	Het
Myo1h	A	T	5: 114,355,209	T704S	probably benign	Het
Nav2	C	A	7: 49,604,585	T2377K	probably benign	Het
Nipbl	T	G	15: 8,360,956	Q276H	probably damaging	Het
Nlrp9b	T	C	7: 20,024,515	L559P	probably damaging	Het
Nup210l	T	A	3: 90,189,438	V1318E	probably damaging	Het
Olfr1427	A	T	19: 12,099,439	S67T	probably damaging	Het
Olfr18	A	G	9: 20,314,411	S170P	probably benign	Het
Olfr385	A	G	11: 73,589,457	Y94H	probably damaging	Het
Olfr765	C	A	10: 129,046,473	V197F	possibly damaging	Het
P2ry13	T	C	3: 59,209,566	T264A	possibly damaging	Het
Plekhg5	T	C	4: 152,114,253	L966P	probably benign	Het
Prss35	A	G	9: 86,755,351	K58R	probably benign	Het
Ptafr	T	A	4: 132,580,079	L260*	probably null	Het
Pum1	A	T	4: 130,779,805	T1157S	possibly damaging	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
Rnf145	A	G	11: 44,555,164	Y275C	probably damaging	Het
Rpl6	A	T	5: 121,208,491	K218N	possibly damaging	Het
Rps6	T	C	4: 86,855,981	T128A	probably benign	Het
Ryr1	G	T	7: 29,067,588		probably benign	Het
Scel	A	T	14: 103,529,984	Q26H	probably damaging	Het
Sfxn4	A	T	19: 60,858,673	D57E	probably benign	Het
Slc35d1	A	C	4: 103,190,847	L240R	probably damaging	Het
Smcr8	A	G	11: 60,779,750	I575V	probably benign	Het
Syk	G	A	13: 52,640,659	M476I	probably damaging	Het
Tbcel	A	T	9: 42,437,243		probably benign	Het
Tob2	C	A	15: 81,858,223	G65W	probably damaging	Het
Trim16	A	G	11: 62,840,694	N464D	probably benign	Het
Trim36	T	C	18: 46,199,709		probably benign	Het
Trpv4	C	A	5: 114,630,529		probably benign	Het
Tsga10	T	A	1: 37,840,519	T64S	possibly damaging	Het
Ttc26	T	C	6: 38,409,435	C364R	probably damaging	Het
Vars2	A	T	17: 35,664,864		probably benign	Het
Vmn1r72	C	A	7: 11,669,694	V276L	probably benign	Het
Vps13a	T	A	19: 16,677,969	K1898N	probably benign	Het
Washc2	T	C	6: 116,220,523		probably benign	Het
Zfp763	A	T	17: 33,019,747	H141Q	probably benign	Het

Other mutations in Vps18

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01627:Vps18	APN	2	119297191	missense	probably benign	0.03
IGL02311:Vps18	APN	2	119290251	missense	probably benign	0.05
IGL02332:Vps18	APN	2	119293810	missense	probably benign	0.04
IGL03089:Vps18	APN	2	119293177	missense	probably benign	0.01
IGL03114:Vps18	APN	2	119293651	missense	possibly damaging	0.55
IGL03334:Vps18	APN	2	119297482	missense	probably damaging	1.00
F5770:Vps18	UTSW	2	119297228	missense	probably benign	0.22
R0311:Vps18	UTSW	2	119297365	missense	probably benign	0.05
R0373:Vps18	UTSW	2	119293905	missense	probably damaging	0.99
R0637:Vps18	UTSW	2	119293905	missense	probably damaging	0.99
R1493:Vps18	UTSW	2	119297132	missense	probably damaging	1.00
R1703:Vps18	UTSW	2	119289057	missense	probably benign	0.03
R1734:Vps18	UTSW	2	119293942	missense	probably benign	0.01
R4297:Vps18	UTSW	2	119297331	nonsense	probably null
R4633:Vps18	UTSW	2	119293276	missense	probably damaging	1.00
R4729:Vps18	UTSW	2	119293791	missense	probably damaging	1.00
R5034:Vps18	UTSW	2	119293306	missense	probably benign	0.00
R5162:Vps18	UTSW	2	119292942	missense	probably benign	0.19
R5320:Vps18	UTSW	2	119297377	nonsense	probably null
R5857:Vps18	UTSW	2	119297533	missense	probably damaging	1.00
R6105:Vps18	UTSW	2	119289062	missense	probably damaging	1.00
R6150:Vps18	UTSW	2	119297592	nonsense	probably null
R7934:Vps18	UTSW	2	119293641	missense	probably benign	0.11
R8018:Vps18	UTSW	2	119294011	missense	probably damaging	1.00
R8147:Vps18	UTSW	2	119292756	missense	probably benign	0.19
R8401:Vps18	UTSW	2	119297492	missense	probably damaging	0.96
R8525:Vps18	UTSW	2	119290230	missense	possibly damaging	0.68
R9044:Vps18	UTSW	2	119297553	missense	probably damaging	1.00
RF002:Vps18	UTSW	2	119297390	missense	probably damaging	1.00
V7583:Vps18	UTSW	2	119297228	missense	probably benign	0.22

Predicted Primers

PCR Primer
(F):5'- AAGAAACTATGGCTCAAGATCGCCC -3'
(R):5'- TCGATAGACCGAATCATCAGCTCCC -3'

Sequencing Primer
(F):5'- TCAAGATCGCCCGGCAC -3'
(R):5'- GCAGTTCCTCAAGTCTGGC -3'

Posted On

2013-05-09