Mutagenetix > Incidental Mutations

Incidental Mutation 'R4576:Plxnd1'

342465

Institutional Source

Beutler Lab

Gene Symbol

Plxnd1

Ensembl Gene

ENSMUSG00000030123

Gene Name

plexin D1

Synonyms

b2b553Clo, 6230425C21Rik, b2b1863Clo

MMRRC Submission

041799-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4576 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

115954811-115995005 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 115968044 bp

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 99 (A99V)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000015511]

Predicted Effect

probably benign
Transcript: ENSMUST00000015511
AA Change: A957V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000015511
Gene: ENSMUSG00000030123
AA Change: A957V

Domain	Start	End	E-Value	Type
signal peptide	1	48	N/A	INTRINSIC
Sema	61	531	6.52e-90	SMART
PSI	550	603	6.06e-12	SMART
PSI	703	755	1.06e-2	SMART
Blast:PSI	850	891	9e-20	BLAST
IPT	892	981	4.43e-20	SMART
IPT	982	1068	6.61e-19	SMART
IPT	1070	1149	6.13e-14	SMART
transmembrane domain	1271	1293	N/A	INTRINSIC
Pfam:Plexin_cytopl	1345	1888	5e-238	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000131590
AA Change: A99V

PolyPhen 2 Score 0.271 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000115650
Gene: ENSMUSG00000030123
AA Change: A99V

Domain	Start	End	E-Value	Type
Blast:PSI	2	34	1e-13	BLAST
IPT	35	124	4.43e-20	SMART
Blast:IPT	125	177	3e-30	BLAST
Pfam:TIG	180	233	4.6e-6	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

98% (84/86)

MGI Phenotype

PHENOTYPE: Homozygous null mice display neonatal lethality, thin-walled atria, and vascular abnormalities including abnormal branchial arch artery development, cardiac outflow tract abnormalities, and reduced vascular smooth muscle around some vessels. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6430531B16Rik	A	G	7: 139,978,130	I51T	probably damaging	Het
Adhfe1	A	T	1: 9,553,754	D160V	probably damaging	Het
AI314180	A	T	4: 58,834,708		probably benign	Het
Ano9	T	C	7: 141,104,138	Q538R	probably damaging	Het
Atp4a	A	G	7: 30,717,722	D510G	probably benign	Het
Atp8a1	T	C	5: 67,815,815		probably benign	Het
Auts2	C	T	5: 132,258,934	G70E	probably benign	Het
C7	A	G	15: 5,002,756	S658P	probably damaging	Het
Cdh9	T	C	15: 16,832,239	V404A	possibly damaging	Het
Cfap54	C	T	10: 93,043,228		probably null	Het
Chml	G	T	1: 175,686,940	Q129K	probably damaging	Het
Chst2	T	C	9: 95,405,171	H374R	probably damaging	Het
Cirbp	A	G	10: 80,170,241	K84E	probably damaging	Het
Cln6	G	T	9: 62,838,949	Q23H	probably benign	Het
Cntn5	A	G	9: 9,673,292	M801T	probably benign	Het
Dapk1	A	T	13: 60,721,822	M293L	probably benign	Het
Ddx11	A	G	17: 66,150,726	K869E	probably damaging	Het
Ddx17	A	T	15: 79,541,146	M108K	probably benign	Het
Dnaaf5	C	A	5: 139,185,639	A557D	probably damaging	Het
Edil3	T	C	13: 89,319,731	Y452H	probably damaging	Het
Elfn1	T	C	5: 139,972,053	S271P	probably benign	Het
Enah	G	A	1: 181,919,563	S298L	possibly damaging	Het
Exoc7	T	C	11: 116,289,183	*685W	probably null	Het
Fam166a	T	C	2: 25,220,288	S71P	probably benign	Het
Fgfbp1	C	T	5: 43,979,464	R162H	probably benign	Het
Foxj3	A	G	4: 119,621,663	S439G	unknown	Het
Fzd9	A	G	5: 135,250,312	S240P	probably damaging	Het
Gin1	A	G	1: 97,792,339	D442G	probably damaging	Het
Gm10804	C	T	2: 93,468,669		noncoding transcript	Het
Gm7102	C	T	19: 61,175,926	G24R	unknown	Het
Grhl3	G	T	4: 135,561,251	T41K	probably damaging	Het
H6pd	A	T	4: 149,994,476	D243E	probably damaging	Het
Heatr6	T	A	11: 83,765,000	S306T	probably benign	Het
Hkdc1	T	C	10: 62,385,843	D812G	possibly damaging	Het
Hmcn1	G	T	1: 150,734,487	T1477K	probably benign	Het
Ift80	A	G	3: 68,950,530	S261P	possibly damaging	Het
Kcnu1	A	T	8: 25,890,020	D424V	probably benign	Het
Kctd1	A	G	18: 15,007,700	S658P	probably damaging	Het
Klk12	A	G	7: 43,773,243	D198G	probably damaging	Het
Kntc1	T	G	5: 123,765,955	L345R	probably damaging	Het
Llph-ps2	A	G	X: 13,218,451		noncoding transcript	Het
Lpxn	T	C	19: 12,833,290	I366T	probably benign	Het
Lrp1	ACAGGCGC	AC	10: 127,540,188		probably benign	Het
Maml3	G	A	3: 51,856,506	Q346*	probably null	Het
Mef2a	T	C	7: 67,240,439	N131S	probably benign	Het
Mlc1	G	A	15: 88,974,537	T136M	probably damaging	Het
Pcdhga9	A	C	18: 37,737,828	N237H	probably damaging	Het
Pde4dip	C	A	3: 97,754,249	E657D	probably damaging	Het
Pknox2	A	G	9: 36,923,548		probably benign	Het
Plcb3	C	T	19: 6,959,047		probably benign	Het
Pnpla2	T	C	7: 141,457,344	S87P	probably damaging	Het
Ppp1r14c	G	T	10: 3,366,912	K82N	probably damaging	Het
Pum3	G	A	19: 27,415,908	T389M	probably benign	Het
Pxdn	A	T	12: 30,011,923	T1165S	probably benign	Het
Rasgrf2	T	C	13: 91,896,410	D925G	possibly damaging	Het
Samhd1	A	T	2: 157,101,750	C615S	probably damaging	Het
Sec16a	A	T	2: 26,431,119	Y1320*	probably null	Het
Slco6b1	T	A	1: 96,988,697		noncoding transcript	Het
Slitrk6	C	A	14: 110,750,170	V702F	probably benign	Het
Spata31d1b	C	A	13: 59,716,861	H608N	probably damaging	Het
Srpr	T	C	9: 35,214,608	I394T	possibly damaging	Het
Svop	C	T	5: 114,065,682	V13M	probably damaging	Het
Tacc3	T	A	5: 33,661,497		probably benign	Het
Tango2	A	T	16: 18,301,528	D146E	probably damaging	Het
Thbs1	G	A	2: 118,119,416	R624Q	probably damaging	Het
Tmem161a	T	C	8: 70,182,063		probably null	Het
Tmem175	A	G	5: 108,644,602	D248G	possibly damaging	Het
Traf3ip2	A	G	10: 39,634,654	N308D	probably damaging	Het
Trim30b	T	C	7: 104,357,331	Y106C	possibly damaging	Het
Trip11	G	A	12: 101,886,240	Q521*	probably null	Het
Tssk5	C	T	15: 76,372,468	R280Q	probably benign	Het
Ttc16	A	T	2: 32,770,059	F246I	probably benign	Het
Unc79	T	C	12: 103,001,803		probably benign	Het
Vmn1r74	A	G	7: 11,846,769		probably null	Het
Vmn2r16	A	T	5: 109,363,799	Y624F	possibly damaging	Het
Zc3h4	G	A	7: 16,434,654	R896H	unknown	Het
Zfp941	T	A	7: 140,811,590	K619*	probably null	Het
Zfp970	A	T	2: 177,475,680	H349L	probably damaging	Het

Other mutations in Plxnd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00764:Plxnd1	APN	6	115967972	missense	possibly damaging	0.51
IGL01099:Plxnd1	APN	6	115969945	missense	probably benign
IGL01323:Plxnd1	APN	6	115966799	missense	possibly damaging	0.81
IGL01382:Plxnd1	APN	6	115960527	missense	probably damaging	1.00
IGL01786:Plxnd1	APN	6	115959935	missense	probably damaging	1.00
IGL02244:Plxnd1	APN	6	115978257	missense	probably benign	0.39
IGL02272:Plxnd1	APN	6	115993628	missense	probably damaging	1.00
IGL02293:Plxnd1	APN	6	115963913	missense	probably damaging	1.00
IGL02465:Plxnd1	APN	6	115955742	makesense	probably null
IGL02873:Plxnd1	APN	6	115959976	missense	probably damaging	1.00
IGL03209:Plxnd1	APN	6	115962357	missense	probably damaging	1.00
Hiss	UTSW	6	115969929	missense	possibly damaging	0.94
murmer	UTSW	6	115968793	missense	probably benign	0.00
mutter	UTSW	6	115968044	missense	probably benign	0.27
R0238:Plxnd1	UTSW	6	115968793	missense	probably benign	0.00
R0238:Plxnd1	UTSW	6	115968793	missense	probably benign	0.00
R0239:Plxnd1	UTSW	6	115968793	missense	probably benign	0.00
R0239:Plxnd1	UTSW	6	115968793	missense	probably benign	0.00
R0357:Plxnd1	UTSW	6	115969460	missense	probably benign	0.00
R0646:Plxnd1	UTSW	6	115958699	splice site	probably benign
R0648:Plxnd1	UTSW	6	115994001	missense	possibly damaging	0.86
R0718:Plxnd1	UTSW	6	115966638	missense	possibly damaging	0.68
R1116:Plxnd1	UTSW	6	115967005	splice site	probably null
R1292:Plxnd1	UTSW	6	115962683	unclassified	probably benign
R1715:Plxnd1	UTSW	6	115968681	missense	probably benign	0.02
R1760:Plxnd1	UTSW	6	115967779	missense	possibly damaging	0.95
R1799:Plxnd1	UTSW	6	115994057	missense	probably damaging	1.00
R1817:Plxnd1	UTSW	6	115980601	missense	possibly damaging	0.83
R1848:Plxnd1	UTSW	6	115966546	missense	probably damaging	1.00
R1851:Plxnd1	UTSW	6	115963914	missense	probably damaging	1.00
R1864:Plxnd1	UTSW	6	115969441	splice site	probably null
R1865:Plxnd1	UTSW	6	115969441	splice site	probably null
R1875:Plxnd1	UTSW	6	115978084	splice site	probably null
R1899:Plxnd1	UTSW	6	115969363	missense	probably benign
R1913:Plxnd1	UTSW	6	115978017	missense	possibly damaging	0.50
R1970:Plxnd1	UTSW	6	115962517	missense	probably damaging	1.00
R2007:Plxnd1	UTSW	6	115967255	missense	probably damaging	1.00
R2134:Plxnd1	UTSW	6	115957548	missense	probably damaging	1.00
R2202:Plxnd1	UTSW	6	115962764	missense	probably benign	0.45
R2230:Plxnd1	UTSW	6	115964144	missense	probably damaging	1.00
R2267:Plxnd1	UTSW	6	115962743	missense	probably benign	0.29
R2427:Plxnd1	UTSW	6	115967748	critical splice donor site	probably null
R4108:Plxnd1	UTSW	6	115959315	missense	probably damaging	1.00
R4233:Plxnd1	UTSW	6	115965953	missense	probably benign	0.30
R4280:Plxnd1	UTSW	6	115956094	splice site	probably benign
R4280:Plxnd1	UTSW	6	115956095	splice site	probably null
R4346:Plxnd1	UTSW	6	115977980	missense	probably benign	0.16
R4439:Plxnd1	UTSW	6	115993976	missense	probably damaging	0.99
R4572:Plxnd1	UTSW	6	115955756	missense	probably damaging	1.00
R4599:Plxnd1	UTSW	6	115994276	missense	probably damaging	1.00
R4614:Plxnd1	UTSW	6	115972525	missense	possibly damaging	0.83
R4700:Plxnd1	UTSW	6	115958615	missense	probably damaging	1.00
R4705:Plxnd1	UTSW	6	115958620	missense	probably damaging	1.00
R4806:Plxnd1	UTSW	6	115960855	missense	probably damaging	1.00
R4944:Plxnd1	UTSW	6	115955765	missense	probably damaging	1.00
R4977:Plxnd1	UTSW	6	115994376	missense	probably damaging	1.00
R5069:Plxnd1	UTSW	6	115965901	missense	probably damaging	0.98
R5155:Plxnd1	UTSW	6	115958988	critical splice donor site	probably null
R5460:Plxnd1	UTSW	6	115957648	missense	probably damaging	1.00
R5729:Plxnd1	UTSW	6	115965877	missense	probably damaging	1.00
R5909:Plxnd1	UTSW	6	115968688	missense	probably benign	0.00
R5992:Plxnd1	UTSW	6	115967787	critical splice acceptor site	probably null
R6129:Plxnd1	UTSW	6	115978174	missense	probably damaging	1.00
R6254:Plxnd1	UTSW	6	115977960	missense	probably benign	0.01
R6273:Plxnd1	UTSW	6	115978492	missense	probably damaging	1.00
R6310:Plxnd1	UTSW	6	115976736	missense	possibly damaging	0.94
R6732:Plxnd1	UTSW	6	115969929	missense	possibly damaging	0.94
R6857:Plxnd1	UTSW	6	115993763	missense	probably benign	0.05
R7243:Plxnd1	UTSW	6	115972507	missense	probably benign	0.00
R7282:Plxnd1	UTSW	6	115960837	missense	probably damaging	1.00
R7632:Plxnd1	UTSW	6	115976639	missense	probably benign
R7699:Plxnd1	UTSW	6	115959794	missense	probably damaging	0.96
R7915:Plxnd1	UTSW	6	115966918	missense	probably benign	0.00
R8090:Plxnd1	UTSW	6	115956617	missense	probably damaging	1.00
R8382:Plxnd1	UTSW	6	115972472	missense	probably benign
R8507:Plxnd1	UTSW	6	115966905	missense	probably damaging	0.97
R8539:Plxnd1	UTSW	6	115962807	missense	possibly damaging	0.94
R8548:Plxnd1	UTSW	6	115957597	missense	probably damaging	1.00
X0024:Plxnd1	UTSW	6	115963310	missense	probably benign	0.02
X0026:Plxnd1	UTSW	6	115966784	missense	possibly damaging	0.88
Z1088:Plxnd1	UTSW	6	115967510	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- CTGCCGTGAATGGTGATCCTTG -3'
(R):5'- TCTCTTGGCCAAACCTACGG -3'

Sequencing Primer
(F):5'- GTGAATGGTGATCCTTGTACCCC -3'
(R):5'- GTGACCATCTACGGAGAACATTGTTG -3'

Posted On

2015-09-24