Mutagenetix > Incidental Mutation

Incidental Mutation 'R4576:Atp4a'

342467

Institutional Source

Beutler Lab

Gene Symbol

Atp4a

Ensembl Gene

ENSMUSG00000005553

Gene Name

ATPase, H+/K+ exchanging, gastric, alpha polypeptide

Synonyms

H+/K+-ATPase alpha, H+K+-transporting alpha 1

MMRRC Submission

041799-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.098) question?

Stock #

R4576 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

30712209-30725534 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 30717722 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 510 (D510G)

Ref Sequence

ENSEMBL: ENSMUSP00000131964 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005692] [ENSMUST00000170371] [ENSMUST00000171014]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000005692
AA Change: D510G

PolyPhen 2 Score 0.250 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000005692
Gene: ENSMUSG00000005553
AA Change: D510G

Domain	Start	End	E-Value	Type
Pfam:H-K_ATPase_N	2	42	5.4e-23	PFAM
Cation_ATPase_N	52	126	2.26e-18	SMART
Pfam:E1-E2_ATPase	144	375	1.1e-57	PFAM
Pfam:Hydrolase	380	739	5.3e-16	PFAM
Pfam:HAD	383	736	1.9e-18	PFAM
Pfam:Cation_ATPase	436	531	1.6e-24	PFAM
Pfam:Cation_ATPase_C	809	1019	4.8e-43	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000165410

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000167761

Predicted Effect

probably benign
Transcript: ENSMUST00000170371
AA Change: D510G

PolyPhen 2 Score 0.250 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000131964
Gene: ENSMUSG00000005553
AA Change: D510G

Domain	Start	End	E-Value	Type
Pfam:H-K_ATPase_N	2	42	4.9e-28	PFAM
Cation_ATPase_N	52	126	2.26e-18	SMART
Pfam:E1-E2_ATPase	145	376	1e-62	PFAM
Pfam:Hydrolase	380	730	9.3e-25	PFAM
Pfam:HAD	383	727	2.1e-15	PFAM
Pfam:Hydrolase_like2	436	531	4e-25	PFAM
Pfam:Cation_ATPase_C	800	1010	1.5e-42	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000171014

Meta Mutation Damage Score

0.5111

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

98% (84/86)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a family of P-type cation-transporting ATPases. The gastric H+, K+-ATPase is a heterodimer consisting of a high molecular weight catalytic alpha subunit and a smaller but heavily glycosylated beta subunit. This enzyme is a proton pump that catalyzes the hydrolysis of ATP coupled with the exchange of H(+) and K(+) ions across the plasma membrane. It is also responsible for gastric acid secretion. This gene encodes a catalytic alpha subunit of the gastric H+, K+-ATPase. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in achlorhydria, hypergastrinemia, and abnormalities of the parietal cells. Mice homozygous for an ENU-induced allele exhibit iron-deficiency anemia. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6430531B16Rik	A	G	7: 139,978,130	I51T	probably damaging	Het
Adhfe1	A	T	1: 9,553,754	D160V	probably damaging	Het
AI314180	A	T	4: 58,834,708		probably benign	Het
Ano9	T	C	7: 141,104,138	Q538R	probably damaging	Het
Atp8a1	T	C	5: 67,815,815		probably benign	Het
Auts2	C	T	5: 132,258,934	G70E	probably benign	Het
C7	A	G	15: 5,002,756	S658P	probably damaging	Het
Cdh9	T	C	15: 16,832,239	V404A	possibly damaging	Het
Cfap54	C	T	10: 93,043,228		probably null	Het
Chml	G	T	1: 175,686,940	Q129K	probably damaging	Het
Chst2	T	C	9: 95,405,171	H374R	probably damaging	Het
Cirbp	A	G	10: 80,170,241	K84E	probably damaging	Het
Cln6	G	T	9: 62,838,949	Q23H	probably benign	Het
Cntn5	A	G	9: 9,673,292	M801T	probably benign	Het
Dapk1	A	T	13: 60,721,822	M293L	probably benign	Het
Ddx11	A	G	17: 66,150,726	K869E	probably damaging	Het
Ddx17	A	T	15: 79,541,146	M108K	probably benign	Het
Dnaaf5	C	A	5: 139,185,639	A557D	probably damaging	Het
Edil3	T	C	13: 89,319,731	Y452H	probably damaging	Het
Elfn1	T	C	5: 139,972,053	S271P	probably benign	Het
Enah	G	A	1: 181,919,563	S298L	possibly damaging	Het
Exoc7	T	C	11: 116,289,183	*685W	probably null	Het
Fam166a	T	C	2: 25,220,288	S71P	probably benign	Het
Fgfbp1	C	T	5: 43,979,464	R162H	probably benign	Het
Foxj3	A	G	4: 119,621,663	S439G	unknown	Het
Fzd9	A	G	5: 135,250,312	S240P	probably damaging	Het
Gin1	A	G	1: 97,792,339	D442G	probably damaging	Het
Gm10804	C	T	2: 93,468,669		noncoding transcript	Het
Gm7102	C	T	19: 61,175,926	G24R	unknown	Het
Grhl3	G	T	4: 135,561,251	T41K	probably damaging	Het
H6pd	A	T	4: 149,994,476	D243E	probably damaging	Het
Heatr6	T	A	11: 83,765,000	S306T	probably benign	Het
Hkdc1	T	C	10: 62,385,843	D812G	possibly damaging	Het
Hmcn1	G	T	1: 150,734,487	T1477K	probably benign	Het
Ift80	A	G	3: 68,950,530	S261P	possibly damaging	Het
Kcnu1	A	T	8: 25,890,020	D424V	probably benign	Het
Kctd1	A	G	18: 15,007,700	S658P	probably damaging	Het
Klk12	A	G	7: 43,773,243	D198G	probably damaging	Het
Kntc1	T	G	5: 123,765,955	L345R	probably damaging	Het
Llph-ps2	A	G	X: 13,218,451		noncoding transcript	Het
Lpxn	T	C	19: 12,833,290	I366T	probably benign	Het
Lrp1	ACAGGCGC	AC	10: 127,540,188		probably benign	Het
Maml3	G	A	3: 51,856,506	Q346*	probably null	Het
Mef2a	T	C	7: 67,240,439	N131S	probably benign	Het
Mlc1	G	A	15: 88,974,537	T136M	probably damaging	Het
Pcdhga9	A	C	18: 37,737,828	N237H	probably damaging	Het
Pde4dip	C	A	3: 97,754,249	E657D	probably damaging	Het
Pknox2	A	G	9: 36,923,548		probably benign	Het
Plcb3	C	T	19: 6,959,047		probably benign	Het
Plxnd1	G	A	6: 115,968,044	A99V	probably benign	Het
Pnpla2	T	C	7: 141,457,344	S87P	probably damaging	Het
Ppp1r14c	G	T	10: 3,366,912	K82N	probably damaging	Het
Pum3	G	A	19: 27,415,908	T389M	probably benign	Het
Pxdn	A	T	12: 30,011,923	T1165S	probably benign	Het
Rasgrf2	T	C	13: 91,896,410	D925G	possibly damaging	Het
Samhd1	A	T	2: 157,101,750	C615S	probably damaging	Het
Sec16a	A	T	2: 26,431,119	Y1320*	probably null	Het
Slco6b1	T	A	1: 96,988,697		noncoding transcript	Het
Slitrk6	C	A	14: 110,750,170	V702F	probably benign	Het
Spata31d1b	C	A	13: 59,716,861	H608N	probably damaging	Het
Srpr	T	C	9: 35,214,608	I394T	possibly damaging	Het
Svop	C	T	5: 114,065,682	V13M	probably damaging	Het
Tacc3	T	A	5: 33,661,497		probably benign	Het
Tango2	A	T	16: 18,301,528	D146E	probably damaging	Het
Thbs1	G	A	2: 118,119,416	R624Q	probably damaging	Het
Tmem161a	T	C	8: 70,182,063		probably null	Het
Tmem175	A	G	5: 108,644,602	D248G	possibly damaging	Het
Traf3ip2	A	G	10: 39,634,654	N308D	probably damaging	Het
Trim30b	T	C	7: 104,357,331	Y106C	possibly damaging	Het
Trip11	G	A	12: 101,886,240	Q521*	probably null	Het
Tssk5	C	T	15: 76,372,468	R280Q	probably benign	Het
Ttc16	A	T	2: 32,770,059	F246I	probably benign	Het
Unc79	T	C	12: 103,001,803		probably benign	Het
Vmn1r74	A	G	7: 11,846,769		probably null	Het
Vmn2r16	A	T	5: 109,363,799	Y624F	possibly damaging	Het
Zc3h4	G	A	7: 16,434,654	R896H	unknown	Het
Zfp941	T	A	7: 140,811,590	K619*	probably null	Het
Zfp970	A	T	2: 177,475,680	H349L	probably damaging	Het

Other mutations in Atp4a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00339:Atp4a	APN	7	30713204	missense	possibly damaging	0.95
IGL01327:Atp4a	APN	7	30713250	missense	possibly damaging	0.96
IGL01510:Atp4a	APN	7	30720791	missense	probably benign	0.02
IGL01763:Atp4a	APN	7	30715518	missense	probably benign	0.20
IGL02061:Atp4a	APN	7	30715029	missense	probably damaging	1.00
IGL02435:Atp4a	APN	7	30717057	missense	probably benign
IGL02903:Atp4a	APN	7	30715919	missense	probably benign	0.00
IGL03181:Atp4a	APN	7	30724704	missense	probably benign	0.02
IGL03350:Atp4a	APN	7	30720867	missense	probably damaging	1.00
atypical	UTSW	7	30715356	missense	possibly damaging	0.84
sublytic	UTSW	7	30715800	missense	probably benign	0.32
IGL03097:Atp4a	UTSW	7	30723037	missense	probably benign	0.14
R0095:Atp4a	UTSW	7	30720735	missense	probably damaging	0.99
R0121:Atp4a	UTSW	7	30720101	missense	probably benign	0.00
R0140:Atp4a	UTSW	7	30720101	missense	probably benign	0.00
R0241:Atp4a	UTSW	7	30717135	missense	probably benign	0.00
R0437:Atp4a	UTSW	7	30720101	missense	probably benign	0.00
R0624:Atp4a	UTSW	7	30718999	missense	probably benign
R1164:Atp4a	UTSW	7	30717692	missense	probably benign	0.00
R2105:Atp4a	UTSW	7	30720368	critical splice donor site	probably null
R2272:Atp4a	UTSW	7	30715500	nonsense	probably null
R2327:Atp4a	UTSW	7	30720241	missense	probably benign	0.16
R2881:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R2990:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R2992:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R2993:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R3123:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R3125:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R3441:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R3442:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R3686:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R3687:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R3845:Atp4a	UTSW	7	30717115	missense	probably null	0.99
R4027:Atp4a	UTSW	7	30724952	splice site	probably null
R4072:Atp4a	UTSW	7	30715332	missense	probably benign	0.09
R4433:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R4454:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R4457:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R4458:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R4510:Atp4a	UTSW	7	30724253	nonsense	probably null
R4511:Atp4a	UTSW	7	30724253	nonsense	probably null
R4656:Atp4a	UTSW	7	30719948	intron	probably benign
R4661:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R4662:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R4852:Atp4a	UTSW	7	30724268	missense	probably benign	0.10
R4892:Atp4a	UTSW	7	30712474	missense	probably benign	0.07
R4907:Atp4a	UTSW	7	30719092	missense	possibly damaging	0.66
R5024:Atp4a	UTSW	7	30715864	missense	possibly damaging	0.82
R5254:Atp4a	UTSW	7	30715530	missense	probably damaging	1.00
R5318:Atp4a	UTSW	7	30715329	missense	probably damaging	1.00
R5340:Atp4a	UTSW	7	30720806	missense	probably benign
R5484:Atp4a	UTSW	7	30720672	unclassified	probably benign
R5729:Atp4a	UTSW	7	30712426	missense	possibly damaging	0.48
R5762:Atp4a	UTSW	7	30719096	missense	probably damaging	0.99
R5797:Atp4a	UTSW	7	30712649	missense	probably damaging	1.00
R6030:Atp4a	UTSW	7	30722516	missense	probably damaging	0.99
R6030:Atp4a	UTSW	7	30722516	missense	probably damaging	0.99
R6077:Atp4a	UTSW	7	30715919	missense	probably benign	0.00
R6243:Atp4a	UTSW	7	30715957	missense	possibly damaging	0.68
R6346:Atp4a	UTSW	7	30715356	missense	possibly damaging	0.84
R6459:Atp4a	UTSW	7	30712462	missense	probably benign	0.00
R6515:Atp4a	UTSW	7	30712478	missense	possibly damaging	0.78
R6773:Atp4a	UTSW	7	30715377	missense	probably damaging	0.98
R6854:Atp4a	UTSW	7	30715008	missense	probably benign	0.29
R7215:Atp4a	UTSW	7	30717360	missense	possibly damaging	0.61
R7271:Atp4a	UTSW	7	30722519	missense	probably benign	0.16
R7340:Atp4a	UTSW	7	30716730	missense	possibly damaging	0.94
R7457:Atp4a	UTSW	7	30720767	missense	probably benign	0.08
R7593:Atp4a	UTSW	7	30724680	missense	probably benign	0.08
R7712:Atp4a	UTSW	7	30715553	missense	probably damaging	0.96
R7762:Atp4a	UTSW	7	30720036	missense	probably damaging	0.96
R8714:Atp4a	UTSW	7	30720588	missense	probably damaging	0.99
R9324:Atp4a	UTSW	7	30715782	missense	probably benign	0.02
Z1177:Atp4a	UTSW	7	30717840	missense	possibly damaging	0.47
Z1186:Atp4a	UTSW	7	30717357	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AGAGCCGAGAACCAATTCTGC -3'
(R):5'- CAAGAAGTTTGGAGGGGTCC -3'

Sequencing Primer
(F):5'- GCCGAGAACCAATTCTGCTTTAGG -3'
(R):5'- TTGATACATAGCCCAGTCCATG -3'

Posted On

2015-09-24