Incidental Mutation 'R4576:Atp4a'
ID342467
Institutional Source Beutler Lab
Gene Symbol Atp4a
Ensembl Gene ENSMUSG00000005553
Gene NameATPase, H+/K+ exchanging, gastric, alpha polypeptide
SynonymsH+/K+-ATPase alpha, H+K+-transporting alpha 1
MMRRC Submission 041799-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R4576 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location30712209-30725534 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30717722 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 510 (D510G)
Ref Sequence ENSEMBL: ENSMUSP00000131964 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005692] [ENSMUST00000170371] [ENSMUST00000171014]
Predicted Effect probably benign
Transcript: ENSMUST00000005692
AA Change: D510G

PolyPhen 2 Score 0.250 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000005692
Gene: ENSMUSG00000005553
AA Change: D510G

DomainStartEndE-ValueType
Pfam:H-K_ATPase_N 2 42 5.4e-23 PFAM
Cation_ATPase_N 52 126 2.26e-18 SMART
Pfam:E1-E2_ATPase 144 375 1.1e-57 PFAM
Pfam:Hydrolase 380 739 5.3e-16 PFAM
Pfam:HAD 383 736 1.9e-18 PFAM
Pfam:Cation_ATPase 436 531 1.6e-24 PFAM
Pfam:Cation_ATPase_C 809 1019 4.8e-43 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165410
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167761
Predicted Effect probably benign
Transcript: ENSMUST00000170371
AA Change: D510G

PolyPhen 2 Score 0.250 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000131964
Gene: ENSMUSG00000005553
AA Change: D510G

DomainStartEndE-ValueType
Pfam:H-K_ATPase_N 2 42 4.9e-28 PFAM
Cation_ATPase_N 52 126 2.26e-18 SMART
Pfam:E1-E2_ATPase 145 376 1e-62 PFAM
Pfam:Hydrolase 380 730 9.3e-25 PFAM
Pfam:HAD 383 727 2.1e-15 PFAM
Pfam:Hydrolase_like2 436 531 4e-25 PFAM
Pfam:Cation_ATPase_C 800 1010 1.5e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171014
Meta Mutation Damage Score 0.5111 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (84/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a family of P-type cation-transporting ATPases. The gastric H+, K+-ATPase is a heterodimer consisting of a high molecular weight catalytic alpha subunit and a smaller but heavily glycosylated beta subunit. This enzyme is a proton pump that catalyzes the hydrolysis of ATP coupled with the exchange of H(+) and K(+) ions across the plasma membrane. It is also responsible for gastric acid secretion. This gene encodes a catalytic alpha subunit of the gastric H+, K+-ATPase. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in achlorhydria, hypergastrinemia, and abnormalities of the parietal cells. Mice homozygous for an ENU-induced allele exhibit iron-deficiency anemia. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430531B16Rik A G 7: 139,978,130 I51T probably damaging Het
Adhfe1 A T 1: 9,553,754 D160V probably damaging Het
AI314180 A T 4: 58,834,708 probably benign Het
Ano9 T C 7: 141,104,138 Q538R probably damaging Het
Atp8a1 T C 5: 67,815,815 probably benign Het
Auts2 C T 5: 132,258,934 G70E probably benign Het
C7 A G 15: 5,002,756 S658P probably damaging Het
Cdh9 T C 15: 16,832,239 V404A possibly damaging Het
Cfap54 C T 10: 93,043,228 probably null Het
Chml G T 1: 175,686,940 Q129K probably damaging Het
Chst2 T C 9: 95,405,171 H374R probably damaging Het
Cirbp A G 10: 80,170,241 K84E probably damaging Het
Cln6 G T 9: 62,838,949 Q23H probably benign Het
Cntn5 A G 9: 9,673,292 M801T probably benign Het
Dapk1 A T 13: 60,721,822 M293L probably benign Het
Ddx11 A G 17: 66,150,726 K869E probably damaging Het
Ddx17 A T 15: 79,541,146 M108K probably benign Het
Dnaaf5 C A 5: 139,185,639 A557D probably damaging Het
Edil3 T C 13: 89,319,731 Y452H probably damaging Het
Elfn1 T C 5: 139,972,053 S271P probably benign Het
Enah G A 1: 181,919,563 S298L possibly damaging Het
Exoc7 T C 11: 116,289,183 *685W probably null Het
Fam166a T C 2: 25,220,288 S71P probably benign Het
Fgfbp1 C T 5: 43,979,464 R162H probably benign Het
Foxj3 A G 4: 119,621,663 S439G unknown Het
Fzd9 A G 5: 135,250,312 S240P probably damaging Het
Gin1 A G 1: 97,792,339 D442G probably damaging Het
Gm10804 C T 2: 93,468,669 noncoding transcript Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Grhl3 G T 4: 135,561,251 T41K probably damaging Het
H6pd A T 4: 149,994,476 D243E probably damaging Het
Heatr6 T A 11: 83,765,000 S306T probably benign Het
Hkdc1 T C 10: 62,385,843 D812G possibly damaging Het
Hmcn1 G T 1: 150,734,487 T1477K probably benign Het
Ift80 A G 3: 68,950,530 S261P possibly damaging Het
Kcnu1 A T 8: 25,890,020 D424V probably benign Het
Kctd1 A G 18: 15,007,700 S658P probably damaging Het
Klk12 A G 7: 43,773,243 D198G probably damaging Het
Kntc1 T G 5: 123,765,955 L345R probably damaging Het
Llph-ps2 A G X: 13,218,451 noncoding transcript Het
Lpxn T C 19: 12,833,290 I366T probably benign Het
Lrp1 ACAGGCGC AC 10: 127,540,188 probably benign Het
Maml3 G A 3: 51,856,506 Q346* probably null Het
Mef2a T C 7: 67,240,439 N131S probably benign Het
Mlc1 G A 15: 88,974,537 T136M probably damaging Het
Pcdhga9 A C 18: 37,737,828 N237H probably damaging Het
Pde4dip C A 3: 97,754,249 E657D probably damaging Het
Pknox2 A G 9: 36,923,548 probably benign Het
Plcb3 C T 19: 6,959,047 probably benign Het
Plxnd1 G A 6: 115,968,044 A99V probably benign Het
Pnpla2 T C 7: 141,457,344 S87P probably damaging Het
Ppp1r14c G T 10: 3,366,912 K82N probably damaging Het
Pum3 G A 19: 27,415,908 T389M probably benign Het
Pxdn A T 12: 30,011,923 T1165S probably benign Het
Rasgrf2 T C 13: 91,896,410 D925G possibly damaging Het
Samhd1 A T 2: 157,101,750 C615S probably damaging Het
Sec16a A T 2: 26,431,119 Y1320* probably null Het
Slco6b1 T A 1: 96,988,697 noncoding transcript Het
Slitrk6 C A 14: 110,750,170 V702F probably benign Het
Spata31d1b C A 13: 59,716,861 H608N probably damaging Het
Srpr T C 9: 35,214,608 I394T possibly damaging Het
Svop C T 5: 114,065,682 V13M probably damaging Het
Tacc3 T A 5: 33,661,497 probably benign Het
Tango2 A T 16: 18,301,528 D146E probably damaging Het
Thbs1 G A 2: 118,119,416 R624Q probably damaging Het
Tmem161a T C 8: 70,182,063 probably null Het
Tmem175 A G 5: 108,644,602 D248G possibly damaging Het
Traf3ip2 A G 10: 39,634,654 N308D probably damaging Het
Trim30b T C 7: 104,357,331 Y106C possibly damaging Het
Trip11 G A 12: 101,886,240 Q521* probably null Het
Tssk5 C T 15: 76,372,468 R280Q probably benign Het
Ttc16 A T 2: 32,770,059 F246I probably benign Het
Unc79 T C 12: 103,001,803 probably benign Het
Vmn1r74 A G 7: 11,846,769 probably null Het
Vmn2r16 A T 5: 109,363,799 Y624F possibly damaging Het
Zc3h4 G A 7: 16,434,654 R896H unknown Het
Zfp941 T A 7: 140,811,590 K619* probably null Het
Zfp970 A T 2: 177,475,680 H349L probably damaging Het
Other mutations in Atp4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Atp4a APN 7 30713204 missense possibly damaging 0.95
IGL01327:Atp4a APN 7 30713250 missense possibly damaging 0.96
IGL01510:Atp4a APN 7 30720791 missense probably benign 0.02
IGL01763:Atp4a APN 7 30715518 missense probably benign 0.20
IGL02061:Atp4a APN 7 30715029 missense probably damaging 1.00
IGL02435:Atp4a APN 7 30717057 missense probably benign
IGL02903:Atp4a APN 7 30715919 missense probably benign 0.00
IGL03181:Atp4a APN 7 30724704 missense probably benign 0.02
IGL03350:Atp4a APN 7 30720867 missense probably damaging 1.00
sublytic UTSW 7 30715800 missense probably benign 0.32
IGL03097:Atp4a UTSW 7 30723037 missense probably benign 0.14
R0095:Atp4a UTSW 7 30720735 missense probably damaging 0.99
R0121:Atp4a UTSW 7 30720101 missense probably benign 0.00
R0140:Atp4a UTSW 7 30720101 missense probably benign 0.00
R0241:Atp4a UTSW 7 30717135 missense probably benign 0.00
R0437:Atp4a UTSW 7 30720101 missense probably benign 0.00
R0624:Atp4a UTSW 7 30718999 missense probably benign
R1164:Atp4a UTSW 7 30717692 missense probably benign 0.00
R2105:Atp4a UTSW 7 30720368 critical splice donor site probably null
R2272:Atp4a UTSW 7 30715500 nonsense probably null
R2327:Atp4a UTSW 7 30720241 missense probably benign 0.16
R2881:Atp4a UTSW 7 30720225 missense probably benign 0.16
R2990:Atp4a UTSW 7 30720225 missense probably benign 0.16
R2992:Atp4a UTSW 7 30720225 missense probably benign 0.16
R2993:Atp4a UTSW 7 30720225 missense probably benign 0.16
R3123:Atp4a UTSW 7 30720225 missense probably benign 0.16
R3125:Atp4a UTSW 7 30720225 missense probably benign 0.16
R3441:Atp4a UTSW 7 30720225 missense probably benign 0.16
R3442:Atp4a UTSW 7 30720225 missense probably benign 0.16
R3686:Atp4a UTSW 7 30720225 missense probably benign 0.16
R3687:Atp4a UTSW 7 30720225 missense probably benign 0.16
R3845:Atp4a UTSW 7 30717115 missense probably null 0.99
R4027:Atp4a UTSW 7 30724952 splice site probably null
R4072:Atp4a UTSW 7 30715332 missense probably benign 0.09
R4433:Atp4a UTSW 7 30720225 missense probably benign 0.16
R4454:Atp4a UTSW 7 30720225 missense probably benign 0.16
R4457:Atp4a UTSW 7 30720225 missense probably benign 0.16
R4458:Atp4a UTSW 7 30720225 missense probably benign 0.16
R4510:Atp4a UTSW 7 30724253 nonsense probably null
R4511:Atp4a UTSW 7 30724253 nonsense probably null
R4656:Atp4a UTSW 7 30719948 intron probably benign
R4661:Atp4a UTSW 7 30720225 missense probably benign 0.16
R4662:Atp4a UTSW 7 30720225 missense probably benign 0.16
R4852:Atp4a UTSW 7 30724268 missense probably benign 0.10
R4892:Atp4a UTSW 7 30712474 missense probably benign 0.07
R4907:Atp4a UTSW 7 30719092 missense possibly damaging 0.66
R5024:Atp4a UTSW 7 30715864 missense possibly damaging 0.82
R5254:Atp4a UTSW 7 30715530 missense probably damaging 1.00
R5318:Atp4a UTSW 7 30715329 missense probably damaging 1.00
R5340:Atp4a UTSW 7 30720806 missense probably benign
R5484:Atp4a UTSW 7 30720672 unclassified probably benign
R5729:Atp4a UTSW 7 30712426 missense possibly damaging 0.48
R5762:Atp4a UTSW 7 30719096 missense probably damaging 0.99
R5797:Atp4a UTSW 7 30712649 missense probably damaging 1.00
R6030:Atp4a UTSW 7 30722516 missense probably damaging 0.99
R6030:Atp4a UTSW 7 30722516 missense probably damaging 0.99
R6077:Atp4a UTSW 7 30715919 missense probably benign 0.00
R6243:Atp4a UTSW 7 30715957 missense possibly damaging 0.68
R6346:Atp4a UTSW 7 30715356 missense possibly damaging 0.84
R6459:Atp4a UTSW 7 30712462 missense probably benign 0.00
R6515:Atp4a UTSW 7 30712478 missense possibly damaging 0.78
R6773:Atp4a UTSW 7 30715377 missense probably damaging 0.98
R6854:Atp4a UTSW 7 30715008 missense probably benign 0.29
R7215:Atp4a UTSW 7 30717360 missense possibly damaging 0.61
R7271:Atp4a UTSW 7 30722519 missense probably benign 0.16
R7340:Atp4a UTSW 7 30716730 missense possibly damaging 0.94
R7457:Atp4a UTSW 7 30720767 missense probably benign 0.08
R7593:Atp4a UTSW 7 30724680 missense probably benign 0.08
R7712:Atp4a UTSW 7 30715553 missense probably damaging 0.96
R7762:Atp4a UTSW 7 30720036 missense probably damaging 0.96
Z1177:Atp4a UTSW 7 30717840 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- AGAGCCGAGAACCAATTCTGC -3'
(R):5'- CAAGAAGTTTGGAGGGGTCC -3'

Sequencing Primer
(F):5'- GCCGAGAACCAATTCTGCTTTAGG -3'
(R):5'- TTGATACATAGCCCAGTCCATG -3'
Posted On2015-09-24