Mutagenetix > Incidental Mutations

Incidental Mutation 'R0346:Nup210l'

34247

Institutional Source

Beutler Lab

Gene Symbol

Nup210l

Ensembl Gene

ENSMUSG00000027939

Gene Name

nucleoporin 210-like

Synonyms

4930548O11Rik, R26-EGFP, Tg(Gt(ROSA)26Sor-EGFP)130910Eps

MMRRC Submission

038553-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.389) question?

Stock #

R0346 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

90104132-90212048 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 90189438 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 1318 (V1318E)

Ref Sequence

ENSEMBL: ENSMUSP00000143368 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029548] [ENSMUST00000200410]

Predicted Effect

probably damaging
Transcript: ENSMUST00000029548
AA Change: V1318E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000029548
Gene: ENSMUSG00000027939
AA Change: V1318E

Domain	Start	End	E-Value	Type
transmembrane domain	13	32	N/A	INTRINSIC
BID_2	457	536	2.05e1	SMART
Blast:S1	949	1023	2e-16	BLAST
BID_2	1077	1152	4.51e-11	SMART
Blast:BID_2	1468	1550	7e-15	BLAST
transmembrane domain	1807	1829	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000200410
AA Change: V1318E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000143368
Gene: ENSMUSG00000027939
AA Change: V1318E

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
BID_2	457	536	6.9e-2	SMART
Blast:S1	938	1023	9e-17	BLAST
BID_2	1077	1152	1.5e-13	SMART
Blast:BID_2	1468	1550	7e-15	BLAST
transmembrane domain	1807	1829	N/A	INTRINSIC

Meta Mutation Damage Score

0.8015

Coding Region Coverage

1x: 99.5%
3x: 98.9%
10x: 97.7%
20x: 96.4%

Validation Efficiency

100% (79/79)

MGI Phenotype

PHENOTYPE: Mice homozygous for a transgene insertion exhibit male infertility, asthenozoospermia, teratozoospermia, azoospermia, and seminiferous tubule degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	A	T	11: 9,566,278	I4406L	probably damaging	Het
Abca16	T	A	7: 120,435,932	C314S	probably damaging	Het
Add3	C	T	19: 53,216,956	R46*	probably null	Het
Alas1	A	T	9: 106,243,351	S82T	possibly damaging	Het
Alkbh5	C	G	11: 60,538,741	R107G	possibly damaging	Het
Ap3b1	A	T	13: 94,445,971	R365*	probably null	Het
Ass1	A	T	2: 31,514,819	N371Y	probably damaging	Het
AU021092	T	C	16: 5,216,854	D168G	possibly damaging	Het
Bcl2	G	A	1: 106,712,562	R107C	probably damaging	Het
Caln1	C	A	5: 130,822,921	H184N	possibly damaging	Het
Camta1	C	A	4: 151,075,140	R1614L	probably damaging	Het
Ccdc191	T	C	16: 43,938,952	V372A	probably damaging	Het
Ccng2	T	G	5: 93,270,894	I126S	probably damaging	Het
Cep85	A	T	4: 134,132,422	N643K	probably damaging	Het
Clvs2	G	C	10: 33,622,546	S129R	possibly damaging	Het
Cntn1	G	T	15: 92,232,087		probably benign	Het
Cttn	A	T	7: 144,452,539		probably benign	Het
Dedd2	T	C	7: 25,211,269	S161G	possibly damaging	Het
Dnajb13	T	C	7: 100,503,925	D263G	probably damaging	Het
Dppa4	T	A	16: 48,289,324		probably benign	Het
Ear2	A	G	14: 44,102,906	E7G	probably damaging	Het
Eif2b4	A	G	5: 31,188,108		probably benign	Het
Etl4	G	T	2: 20,759,652		probably null	Het
Fbxo15	T	A	18: 84,960,221		probably null	Het
Gm8765	T	C	13: 50,703,310	Y995H	probably benign	Het
Gm9970	A	G	5: 31,240,838		probably benign	Het
Hap1	A	G	11: 100,356,029	S17P	probably benign	Het
Hgd	C	T	16: 37,588,774		probably benign	Het
Inpp5f	T	A	7: 128,690,668	L16Q	probably damaging	Het
Islr2	G	A	9: 58,198,343	R545*	probably null	Het
Itgav	G	T	2: 83,792,609	C675F	probably damaging	Het
Kif13a	T	A	13: 46,814,219	I403L	possibly damaging	Het
Kif14	T	A	1: 136,468,160	I68N	probably damaging	Het
Kif26a	G	T	12: 112,179,348	K1764N	probably null	Het
Lrrd1	C	A	5: 3,850,215	F173L	probably benign	Het
Mroh4	G	C	15: 74,614,292		probably benign	Het
Mrvi1	T	C	7: 110,898,976	D404G	probably damaging	Het
Msh5	A	G	17: 35,029,888	V723A	probably benign	Het
Mybph	T	G	1: 134,197,754	I279S	probably damaging	Het
Myh4	A	T	11: 67,260,326	I1936L	probably benign	Het
Myo1h	A	T	5: 114,355,209	T704S	probably benign	Het
Nav2	C	A	7: 49,604,585	T2377K	probably benign	Het
Nipbl	T	G	15: 8,360,956	Q276H	probably damaging	Het
Nlrp9b	T	C	7: 20,024,515	L559P	probably damaging	Het
Olfr1427	A	T	19: 12,099,439	S67T	probably damaging	Het
Olfr18	A	G	9: 20,314,411	S170P	probably benign	Het
Olfr385	A	G	11: 73,589,457	Y94H	probably damaging	Het
Olfr765	C	A	10: 129,046,473	V197F	possibly damaging	Het
P2ry13	T	C	3: 59,209,566	T264A	possibly damaging	Het
Plekhg5	T	C	4: 152,114,253	L966P	probably benign	Het
Prss35	A	G	9: 86,755,351	K58R	probably benign	Het
Ptafr	T	A	4: 132,580,079	L260*	probably null	Het
Pum1	A	T	4: 130,779,805	T1157S	possibly damaging	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
Rnf145	A	G	11: 44,555,164	Y275C	probably damaging	Het
Rpl6	A	T	5: 121,208,491	K218N	possibly damaging	Het
Rps6	T	C	4: 86,855,981	T128A	probably benign	Het
Ryr1	G	T	7: 29,067,588		probably benign	Het
Scel	A	T	14: 103,529,984	Q26H	probably damaging	Het
Sfxn4	A	T	19: 60,858,673	D57E	probably benign	Het
Slc35d1	A	C	4: 103,190,847	L240R	probably damaging	Het
Smcr8	A	G	11: 60,779,750	I575V	probably benign	Het
Syk	G	A	13: 52,640,659	M476I	probably damaging	Het
Tbcel	A	T	9: 42,437,243		probably benign	Het
Tob2	C	A	15: 81,858,223	G65W	probably damaging	Het
Trim16	A	G	11: 62,840,694	N464D	probably benign	Het
Trim36	T	C	18: 46,199,709		probably benign	Het
Trpv4	C	A	5: 114,630,529		probably benign	Het
Tsga10	T	A	1: 37,840,519	T64S	possibly damaging	Het
Ttc26	T	C	6: 38,409,435	C364R	probably damaging	Het
Vars2	A	T	17: 35,664,864		probably benign	Het
Vmn1r72	C	A	7: 11,669,694	V276L	probably benign	Het
Vps13a	T	A	19: 16,677,969	K1898N	probably benign	Het
Vps18	A	G	2: 119,297,164	M823V	probably damaging	Het
Washc2	T	C	6: 116,220,523		probably benign	Het
Zfp763	A	T	17: 33,019,747	H141Q	probably benign	Het

Other mutations in Nup210l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00780:Nup210l	APN	3	90190849	splice site	probably benign
IGL00813:Nup210l	APN	3	90132418	missense	probably benign	0.00
IGL01375:Nup210l	APN	3	90159893	missense	probably damaging	0.96
IGL01731:Nup210l	APN	3	90154566	missense	probably damaging	1.00
IGL01786:Nup210l	APN	3	90122776	nonsense	probably null
IGL01958:Nup210l	APN	3	90203924	missense	possibly damaging	0.74
IGL02094:Nup210l	APN	3	90180213	critical splice donor site	probably null
IGL02120:Nup210l	APN	3	90136862	missense	probably damaging	1.00
IGL02313:Nup210l	APN	3	90122792	missense	probably damaging	1.00
IGL02336:Nup210l	APN	3	90181552	critical splice donor site	probably null
IGL02348:Nup210l	APN	3	90104164	utr 5 prime	probably benign
IGL02372:Nup210l	APN	3	90201971	missense	possibly damaging	0.80
IGL02557:Nup210l	APN	3	90124230	missense	probably damaging	1.00
IGL02559:Nup210l	APN	3	90159953	missense	probably benign	0.02
IGL02738:Nup210l	APN	3	90136850	missense	possibly damaging	0.80
IGL03231:Nup210l	APN	3	90189545	missense	probably damaging	1.00
IGL03257:Nup210l	APN	3	90180148	critical splice acceptor site	probably null
IGL03388:Nup210l	APN	3	90170044	missense	probably damaging	1.00
IGL03134:Nup210l	UTSW	3	90190887	missense	possibly damaging	0.85
R0003:Nup210l	UTSW	3	90119911	missense	probably damaging	1.00
R0040:Nup210l	UTSW	3	90181905	missense	probably damaging	1.00
R0083:Nup210l	UTSW	3	90189575	missense	probably damaging	1.00
R0090:Nup210l	UTSW	3	90211779	missense	probably benign	0.00
R0108:Nup210l	UTSW	3	90189575	missense	probably damaging	1.00
R0142:Nup210l	UTSW	3	90172113	missense	probably damaging	1.00
R0306:Nup210l	UTSW	3	90207368	missense	probably benign	0.13
R0332:Nup210l	UTSW	3	90132309	splice site	probably benign
R0463:Nup210l	UTSW	3	90180211	missense	probably null	1.00
R0622:Nup210l	UTSW	3	90167740	missense	probably damaging	0.98
R0765:Nup210l	UTSW	3	90119877	missense	probably damaging	0.99
R0990:Nup210l	UTSW	3	90211925	missense	probably benign	0.00
R1014:Nup210l	UTSW	3	90170048	missense	possibly damaging	0.62
R1036:Nup210l	UTSW	3	90192940	splice site	probably benign
R1177:Nup210l	UTSW	3	90202003	missense	probably benign	0.11
R1183:Nup210l	UTSW	3	90159945	missense	probably benign	0.04
R1188:Nup210l	UTSW	3	90198179	missense	probably benign	0.16
R1457:Nup210l	UTSW	3	90190972	missense	possibly damaging	0.68
R1471:Nup210l	UTSW	3	90170562	missense	probably benign
R1627:Nup210l	UTSW	3	90144169	missense	probably benign	0.15
R1778:Nup210l	UTSW	3	90189486	missense	probably damaging	0.99
R1827:Nup210l	UTSW	3	90154557	missense	probably damaging	1.00
R1843:Nup210l	UTSW	3	90172086	missense	probably damaging	0.96
R1858:Nup210l	UTSW	3	90154499	missense	probably damaging	0.97
R1942:Nup210l	UTSW	3	90151237	missense	probably benign	0.01
R2015:Nup210l	UTSW	3	90185432	missense	probably damaging	1.00
R2113:Nup210l	UTSW	3	90190974	missense	possibly damaging	0.48
R2944:Nup210l	UTSW	3	90181545	missense	probably damaging	1.00
R3736:Nup210l	UTSW	3	90120013	missense	probably damaging	1.00
R3740:Nup210l	UTSW	3	90207394	missense	probably benign	0.08
R3741:Nup210l	UTSW	3	90207394	missense	probably benign	0.08
R3742:Nup210l	UTSW	3	90207394	missense	probably benign	0.08
R3771:Nup210l	UTSW	3	90119894	nonsense	probably null
R3773:Nup210l	UTSW	3	90119894	nonsense	probably null
R3879:Nup210l	UTSW	3	90185473	missense	probably damaging	1.00
R3882:Nup210l	UTSW	3	90124210	missense	probably benign	0.19
R3953:Nup210l	UTSW	3	90193054	missense	possibly damaging	0.89
R3954:Nup210l	UTSW	3	90193054	missense	possibly damaging	0.89
R3955:Nup210l	UTSW	3	90193054	missense	possibly damaging	0.89
R3956:Nup210l	UTSW	3	90193054	missense	possibly damaging	0.89
R4200:Nup210l	UTSW	3	90119911	missense	probably damaging	1.00
R4290:Nup210l	UTSW	3	90207326	missense	probably benign	0.00
R4328:Nup210l	UTSW	3	90175835	splice site	probably null
R4629:Nup210l	UTSW	3	90167875	missense	probably benign	0.21
R4629:Nup210l	UTSW	3	90190874	nonsense	probably null
R4897:Nup210l	UTSW	3	90193071	missense	probably damaging	1.00
R4906:Nup210l	UTSW	3	90170030	missense	probably benign	0.06
R4966:Nup210l	UTSW	3	90106901	missense	probably benign	0.00
R5004:Nup210l	UTSW	3	90180165	nonsense	probably null
R5237:Nup210l	UTSW	3	90180198	missense	probably benign	0.00
R5499:Nup210l	UTSW	3	90174370	missense	probably damaging	1.00
R5522:Nup210l	UTSW	3	90154665	missense	probably benign	0.10
R5627:Nup210l	UTSW	3	90144250	missense	probably damaging	0.97
R5678:Nup210l	UTSW	3	90190959	missense	probably damaging	0.99
R5726:Nup210l	UTSW	3	90129207	intron	probably null
R5792:Nup210l	UTSW	3	90199857	missense	probably damaging	1.00
R6129:Nup210l	UTSW	3	90104176	missense	probably benign	0.00
R6272:Nup210l	UTSW	3	90170024	missense	possibly damaging	0.57
R6290:Nup210l	UTSW	3	90119909	nonsense	probably null
R6293:Nup210l	UTSW	3	90115064	missense	probably damaging	1.00
R6446:Nup210l	UTSW	3	90172068	missense	probably damaging	1.00
R6698:Nup210l	UTSW	3	90182508	missense	possibly damaging	0.57
R6855:Nup210l	UTSW	3	90136924	missense	probably benign	0.01
R6895:Nup210l	UTSW	3	90159924	missense	probably damaging	0.97
R6899:Nup210l	UTSW	3	90167897	missense	possibly damaging	0.77
R6978:Nup210l	UTSW	3	90154566	missense	possibly damaging	0.86
R6980:Nup210l	UTSW	3	90119927	missense	probably benign	0.04
R7038:Nup210l	UTSW	3	90159947	missense	probably damaging	1.00
R7273:Nup210l	UTSW	3	90118547	missense	probably benign	0.04
R7450:Nup210l	UTSW	3	90115188	critical splice donor site	probably null
R7514:Nup210l	UTSW	3	90210459	critical splice donor site	probably null
R7658:Nup210l	UTSW	3	90211993	missense	probably benign	0.43
R7735:Nup210l	UTSW	3	90185576	missense	probably damaging	1.00
R7772:Nup210l	UTSW	3	90159926	missense	probably damaging	1.00
R7800:Nup210l	UTSW	3	90134597	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGAGCTGACATGCTCTCTGTGC -3'
(R):5'- TGATTTAGTCCCTGACTCGCCTGG -3'

Sequencing Primer
(F):5'- tgagatggggttttcccatatag -3'
(R):5'- CGCCTGGACTCCAGTTATG -3'

Posted On

2013-05-09