Incidental Mutation 'R4576:Pxdn'
ID342488
Institutional Source Beutler Lab
Gene Symbol Pxdn
Ensembl Gene ENSMUSG00000020674
Gene Nameperoxidasin
SynonymsVPO1, 2310075M15Rik
MMRRC Submission 041799-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.526) question?
Stock #R4576 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location29937608-30017658 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 30011923 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 1165 (T1165S)
Ref Sequence ENSEMBL: ENSMUSP00000151320 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000122328] [ENSMUST00000220271]
Predicted Effect probably benign
Transcript: ENSMUST00000122328
AA Change: T1345S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113703
Gene: ENSMUSG00000020674
AA Change: T1345S

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LRRNT 32 63 2.52e-1 SMART
LRR 62 81 4.09e1 SMART
LRR_TYP 82 105 3.69e-4 SMART
LRR_TYP 106 129 1.45e-2 SMART
LRR_TYP 130 153 8.02e-5 SMART
LRR_TYP 154 177 1.06e-4 SMART
LRRCT 189 241 3.97e-5 SMART
IGc2 255 321 1.59e-15 SMART
IGc2 351 416 3.96e-16 SMART
IGc2 442 506 2.96e-15 SMART
IGc2 534 598 1.2e-15 SMART
Pfam:An_peroxidase 738 1286 1.1e-196 PFAM
VWC 1411 1466 8.8e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218620
Predicted Effect probably benign
Transcript: ENSMUST00000220271
AA Change: T1165S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0591 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (84/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a heme-containing peroxidase that is secreted into the extracellular matrix. It is involved in extracellular matrix formation, and may function in the physiological and pathological fibrogenic response in fibrotic kidney. Mutations in this gene cause corneal opacification and other ocular anomalies, and also microphthalmia and anterior segment dysgenesis. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit abnormal eye development with early-onset glaucoma and progressive retinal dysgenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430531B16Rik A G 7: 139,978,130 I51T probably damaging Het
Adhfe1 A T 1: 9,553,754 D160V probably damaging Het
AI314180 A T 4: 58,834,708 probably benign Het
Ano9 T C 7: 141,104,138 Q538R probably damaging Het
Atp4a A G 7: 30,717,722 D510G probably benign Het
Atp8a1 T C 5: 67,815,815 probably benign Het
Auts2 C T 5: 132,258,934 G70E probably benign Het
C7 A G 15: 5,002,756 S658P probably damaging Het
Cdh9 T C 15: 16,832,239 V404A possibly damaging Het
Cfap54 C T 10: 93,043,228 probably null Het
Chml G T 1: 175,686,940 Q129K probably damaging Het
Chst2 T C 9: 95,405,171 H374R probably damaging Het
Cirbp A G 10: 80,170,241 K84E probably damaging Het
Cln6 G T 9: 62,838,949 Q23H probably benign Het
Cntn5 A G 9: 9,673,292 M801T probably benign Het
Dapk1 A T 13: 60,721,822 M293L probably benign Het
Ddx11 A G 17: 66,150,726 K869E probably damaging Het
Ddx17 A T 15: 79,541,146 M108K probably benign Het
Dnaaf5 C A 5: 139,185,639 A557D probably damaging Het
Edil3 T C 13: 89,319,731 Y452H probably damaging Het
Elfn1 T C 5: 139,972,053 S271P probably benign Het
Enah G A 1: 181,919,563 S298L possibly damaging Het
Exoc7 T C 11: 116,289,183 *685W probably null Het
Fam166a T C 2: 25,220,288 S71P probably benign Het
Fgfbp1 C T 5: 43,979,464 R162H probably benign Het
Foxj3 A G 4: 119,621,663 S439G unknown Het
Fzd9 A G 5: 135,250,312 S240P probably damaging Het
Gin1 A G 1: 97,792,339 D442G probably damaging Het
Gm10804 C T 2: 93,468,669 noncoding transcript Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Grhl3 G T 4: 135,561,251 T41K probably damaging Het
H6pd A T 4: 149,994,476 D243E probably damaging Het
Heatr6 T A 11: 83,765,000 S306T probably benign Het
Hkdc1 T C 10: 62,385,843 D812G possibly damaging Het
Hmcn1 G T 1: 150,734,487 T1477K probably benign Het
Ift80 A G 3: 68,950,530 S261P possibly damaging Het
Kcnu1 A T 8: 25,890,020 D424V probably benign Het
Kctd1 A G 18: 15,007,700 S658P probably damaging Het
Klk12 A G 7: 43,773,243 D198G probably damaging Het
Kntc1 T G 5: 123,765,955 L345R probably damaging Het
Llph-ps2 A G X: 13,218,451 noncoding transcript Het
Lpxn T C 19: 12,833,290 I366T probably benign Het
Lrp1 ACAGGCGC AC 10: 127,540,188 probably benign Het
Maml3 G A 3: 51,856,506 Q346* probably null Het
Mef2a T C 7: 67,240,439 N131S probably benign Het
Mlc1 G A 15: 88,974,537 T136M probably damaging Het
Pcdhga9 A C 18: 37,737,828 N237H probably damaging Het
Pde4dip C A 3: 97,754,249 E657D probably damaging Het
Pknox2 A G 9: 36,923,548 probably benign Het
Plcb3 C T 19: 6,959,047 probably benign Het
Plxnd1 G A 6: 115,968,044 A99V probably benign Het
Pnpla2 T C 7: 141,457,344 S87P probably damaging Het
Ppp1r14c G T 10: 3,366,912 K82N probably damaging Het
Pum3 G A 19: 27,415,908 T389M probably benign Het
Rasgrf2 T C 13: 91,896,410 D925G possibly damaging Het
Samhd1 A T 2: 157,101,750 C615S probably damaging Het
Sec16a A T 2: 26,431,119 Y1320* probably null Het
Slco6b1 T A 1: 96,988,697 noncoding transcript Het
Slitrk6 C A 14: 110,750,170 V702F probably benign Het
Spata31d1b C A 13: 59,716,861 H608N probably damaging Het
Srpr T C 9: 35,214,608 I394T possibly damaging Het
Svop C T 5: 114,065,682 V13M probably damaging Het
Tacc3 T A 5: 33,661,497 probably benign Het
Tango2 A T 16: 18,301,528 D146E probably damaging Het
Thbs1 G A 2: 118,119,416 R624Q probably damaging Het
Tmem161a T C 8: 70,182,063 probably null Het
Tmem175 A G 5: 108,644,602 D248G possibly damaging Het
Traf3ip2 A G 10: 39,634,654 N308D probably damaging Het
Trim30b T C 7: 104,357,331 Y106C possibly damaging Het
Trip11 G A 12: 101,886,240 Q521* probably null Het
Tssk5 C T 15: 76,372,468 R280Q probably benign Het
Ttc16 A T 2: 32,770,059 F246I probably benign Het
Unc79 T C 12: 103,001,803 probably benign Het
Vmn1r74 A G 7: 11,846,769 probably null Het
Vmn2r16 A T 5: 109,363,799 Y624F possibly damaging Het
Zc3h4 G A 7: 16,434,654 R896H unknown Het
Zfp941 T A 7: 140,811,590 K619* probably null Het
Zfp970 A T 2: 177,475,680 H349L probably damaging Het
Other mutations in Pxdn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Pxdn APN 12 29987099 missense probably damaging 1.00
IGL01152:Pxdn APN 12 30001937 missense probably damaging 0.99
IGL01286:Pxdn APN 12 29982754 missense probably benign 0.04
IGL01323:Pxdn APN 12 29987137 missense probably benign 0.00
IGL01338:Pxdn APN 12 30002797 missense probably damaging 1.00
IGL01341:Pxdn APN 12 30002487 missense probably damaging 1.00
IGL01401:Pxdn APN 12 30001984 missense probably damaging 1.00
IGL01580:Pxdn APN 12 29984493 missense probably benign 0.18
IGL01650:Pxdn APN 12 30002401 missense probably benign 0.01
IGL01679:Pxdn APN 12 29999902 missense probably damaging 0.97
IGL01866:Pxdn APN 12 29984571 missense probably benign 0.02
IGL02354:Pxdn APN 12 29999189 missense probably damaging 1.00
IGL02361:Pxdn APN 12 29999189 missense probably damaging 1.00
IGL02427:Pxdn APN 12 29984532 missense probably damaging 1.00
IGL02955:Pxdn APN 12 30003157 missense probably damaging 1.00
IGL03079:Pxdn APN 12 30002998 missense probably damaging 0.97
IGL03111:Pxdn APN 12 29982756 missense probably damaging 0.99
IGL02988:Pxdn UTSW 12 30003114 nonsense probably null
PIT4280001:Pxdn UTSW 12 29995328 missense probably damaging 0.99
PIT4469001:Pxdn UTSW 12 30005829 missense probably benign 0.00
R0070:Pxdn UTSW 12 29982727 missense probably damaging 0.99
R0070:Pxdn UTSW 12 29982727 missense probably damaging 0.99
R0086:Pxdn UTSW 12 30002419 missense possibly damaging 0.95
R0140:Pxdn UTSW 12 29982754 missense probably benign 0.04
R0201:Pxdn UTSW 12 30002431 missense possibly damaging 0.79
R0282:Pxdn UTSW 12 29984440 nonsense probably null
R0310:Pxdn UTSW 12 30015529 missense probably damaging 1.00
R0426:Pxdn UTSW 12 29987066 missense possibly damaging 0.89
R0468:Pxdn UTSW 12 29994486 missense probably damaging 0.99
R0825:Pxdn UTSW 12 29984996 splice site probably benign
R0885:Pxdn UTSW 12 30003402 missense probably benign 0.30
R1420:Pxdn UTSW 12 30002068 missense probably damaging 1.00
R1588:Pxdn UTSW 12 30002559 missense probably damaging 1.00
R2269:Pxdn UTSW 12 30005775 missense probably damaging 0.97
R2280:Pxdn UTSW 12 29984906 missense probably damaging 0.98
R2504:Pxdn UTSW 12 30003406 missense probably damaging 1.00
R2679:Pxdn UTSW 12 29975569 splice site probably benign
R3116:Pxdn UTSW 12 30002307 missense possibly damaging 0.89
R3607:Pxdn UTSW 12 29990918 missense probably benign 0.04
R4033:Pxdn UTSW 12 30003225 missense probably benign 0.19
R4659:Pxdn UTSW 12 29994553 missense probably benign 0.01
R4681:Pxdn UTSW 12 30012326 missense probably benign 0.45
R4968:Pxdn UTSW 12 30000012 missense probably benign 0.25
R5032:Pxdn UTSW 12 30003141 missense probably benign 0.08
R5232:Pxdn UTSW 12 29990988 missense probably benign 0.08
R5366:Pxdn UTSW 12 30002900 missense probably damaging 1.00
R5504:Pxdn UTSW 12 30002801 missense probably damaging 1.00
R5586:Pxdn UTSW 12 30003142 missense probably damaging 0.99
R5739:Pxdn UTSW 12 29982334 missense probably benign 0.03
R5877:Pxdn UTSW 12 30003046 missense probably damaging 1.00
R6167:Pxdn UTSW 12 29974001 missense probably damaging 1.00
R6191:Pxdn UTSW 12 29982717 missense possibly damaging 0.94
R6200:Pxdn UTSW 12 30003112 missense probably damaging 1.00
R6609:Pxdn UTSW 12 30002941 missense probably benign 0.00
R6628:Pxdn UTSW 12 29999918 missense probably damaging 1.00
R6865:Pxdn UTSW 12 30014583 splice site probably null
R6921:Pxdn UTSW 12 30015505 missense probably damaging 0.96
R6995:Pxdn UTSW 12 29995371 missense possibly damaging 0.95
R7211:Pxdn UTSW 12 29984904 missense possibly damaging 0.77
R7220:Pxdn UTSW 12 29994480 missense probably benign 0.02
R7347:Pxdn UTSW 12 30012261 missense probably benign 0.01
R7402:Pxdn UTSW 12 30002439 missense probably damaging 1.00
R7408:Pxdn UTSW 12 29990945 missense probably benign 0.29
R7413:Pxdn UTSW 12 30002928 missense probably benign 0.00
R7447:Pxdn UTSW 12 29984927 missense probably damaging 1.00
R7572:Pxdn UTSW 12 30006705 missense probably damaging 1.00
R7708:Pxdn UTSW 12 30006602 missense probably damaging 0.99
R7815:Pxdn UTSW 12 30005825 missense probably damaging 0.96
R8097:Pxdn UTSW 12 30006602 missense probably damaging 0.99
R8098:Pxdn UTSW 12 30006602 missense probably damaging 0.99
Z1177:Pxdn UTSW 12 29990852 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTGCTGCCTGATATTCCTG -3'
(R):5'- GACTCTGAACTCTGGGGCATTTC -3'

Sequencing Primer
(F):5'- GATGGGTCATACAAGTAGCTCCTAC -3'
(R):5'- GCATTTCTGCTATAGCCAAACTAGG -3'
Posted On2015-09-24