Incidental Mutation 'R4577:Speg'
ID 342512
Institutional Source Beutler Lab
Gene Symbol Speg
Ensembl Gene ENSMUSG00000026207
Gene Name SPEG complex locus
Synonyms SPEGbeta, Apeg1, SPEGalpha, D1Bwg1450e, SPEG, BPEG
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4577 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 75375297-75432320 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 75415395 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 1607 (D1607G)
Ref Sequence ENSEMBL: ENSMUSP00000084361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087122]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000087122
AA Change: D1607G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000084361
Gene: ENSMUSG00000026207
AA Change: D1607G

DomainStartEndE-ValueType
IG 51 128 1.48e-6 SMART
low complexity region 292 318 N/A INTRINSIC
low complexity region 325 338 N/A INTRINSIC
low complexity region 359 368 N/A INTRINSIC
low complexity region 412 423 N/A INTRINSIC
low complexity region 573 584 N/A INTRINSIC
IGc2 739 806 2.19e-9 SMART
Pfam:SPEG_u2 817 873 2.4e-36 PFAM
IGc2 886 954 4.03e-8 SMART
IG 979 1064 1.05e-6 SMART
IGc2 1081 1148 2.19e-9 SMART
IG 1199 1283 6.87e-2 SMART
FN3 1287 1373 1.38e-4 SMART
IG 1401 1487 2.64e-3 SMART
IGc2 1502 1569 1.12e-6 SMART
STYKc 1606 1859 8.44e-63 SMART
Blast:STYKc 1861 1895 6e-12 BLAST
low complexity region 1918 1939 N/A INTRINSIC
low complexity region 2069 2081 N/A INTRINSIC
low complexity region 2208 2227 N/A INTRINSIC
low complexity region 2230 2249 N/A INTRINSIC
low complexity region 2255 2269 N/A INTRINSIC
low complexity region 2343 2366 N/A INTRINSIC
low complexity region 2410 2422 N/A INTRINSIC
low complexity region 2433 2451 N/A INTRINSIC
low complexity region 2457 2487 N/A INTRINSIC
low complexity region 2524 2544 N/A INTRINSIC
IGc2 2599 2667 2.05e-9 SMART
FN3 2681 2760 2.5e-2 SMART
low complexity region 2775 2789 N/A INTRINSIC
low complexity region 2802 2831 N/A INTRINSIC
low complexity region 2912 2927 N/A INTRINSIC
STYKc 2961 3213 4.42e-66 SMART
low complexity region 3241 3250 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000137868
AA Change: D1354G
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein with similarity to members of the myosin light chain kinase family. This protein family is required for myocyte cytoskeletal development. Studies have determined that a lack of this protein affected myocardial development. Multiple alternatively spliced transcript variants that encode different protein isoforms have been defined. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele die during the early postnatal period with enlarged, dilated hearts, and decreased cardiac function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430531B16Rik A G 7: 139,978,130 I51T probably damaging Het
Abca1 C A 4: 53,062,568 C1429F possibly damaging Het
Acacb A G 5: 114,226,831 E1524G probably damaging Het
Ankrd50 A G 3: 38,455,941 V759A probably damaging Het
Ano9 T C 7: 141,104,138 Q538R probably damaging Het
Bnip2 A G 9: 69,997,162 D67G probably benign Het
Cacna1e A T 1: 154,402,027 S2060T possibly damaging Het
Cand2 G A 6: 115,791,259 C455Y probably damaging Het
Cdh16 T C 8: 104,618,559 D366G probably damaging Het
Cep170b A G 12: 112,744,718 R595G probably damaging Het
Chaf1a G A 17: 56,065,184 R784Q probably damaging Het
Clca4a C A 3: 144,954,969 S698I probably damaging Het
Dnah5 A C 15: 28,289,250 Y1195S probably benign Het
Dysf T C 6: 84,137,326 I1229T probably damaging Het
Eef2 GCCC GCCCC 10: 81,178,767 probably null Het
Ep300 T C 15: 81,649,009 S1756P unknown Het
Ep300 T A 15: 81,611,410 probably benign Het
F3 A G 3: 121,734,114 I254V probably benign Het
Fam166a T C 2: 25,220,288 S71P probably benign Het
Frmd4a C A 2: 4,603,679 A786E possibly damaging Het
Fsd1l T C 4: 53,686,397 F270S probably damaging Het
Galnt3 T C 2: 66,097,859 Y231C probably benign Het
Gm10220 A C 5: 26,117,871 I181S probably benign Het
Gm13178 A C 4: 144,703,753 I222S probably damaging Het
Gnb5 G A 9: 75,343,541 V316I possibly damaging Het
Gys2 A G 6: 142,454,510 F325S possibly damaging Het
Hmgn2 G A 4: 133,967,357 probably benign Het
Hsph1 A G 5: 149,618,843 V705A probably benign Het
Ighg2b T C 12: 113,306,892 E206G unknown Het
Iqub A T 6: 24,501,291 I220N probably damaging Het
Jmjd1c A G 10: 67,249,750 T2259A probably damaging Het
Kcnq3 T C 15: 66,286,214 K4R unknown Het
Klk12 A G 7: 43,773,243 D198G probably damaging Het
L3mbtl2 G A 15: 81,686,285 E655K probably benign Het
Lrp1b C T 2: 40,821,719 C3163Y probably damaging Het
Map3k19 T A 1: 127,822,813 R934* probably null Het
Map4 A G 9: 110,081,421 T1061A possibly damaging Het
Mbnl1 G A 3: 60,529,778 V50I probably damaging Het
Med15 G A 16: 17,674,515 Q132* probably null Het
Mef2a T C 7: 67,240,439 N131S probably benign Het
Mtmr3 G C 11: 4,497,375 L361V probably damaging Het
Myo5a A G 9: 75,217,545 E1792G probably damaging Het
Nup88 C A 11: 70,969,717 A55S probably damaging Het
Olfr1252 T C 2: 89,722,043 K23E possibly damaging Het
Olfr374 T A 8: 72,110,323 Y252* probably null Het
Pacs1 G T 19: 5,143,833 S556* probably null Het
Parp4 A G 14: 56,590,410 E206G probably benign Het
Paxbp1 T G 16: 91,015,154 K889N probably damaging Het
Pcdhga2 G A 18: 37,669,249 A49T possibly damaging Het
Pcsk6 T A 7: 65,959,266 L292* probably null Het
Plb1 C T 5: 32,247,557 Q20* probably null Het
Plec C A 15: 76,184,069 Q1142H possibly damaging Het
Pnpla2 T C 7: 141,457,344 S87P probably damaging Het
Prss28 T C 17: 25,310,105 V140A probably damaging Het
Rad17 A T 13: 100,633,278 S258T probably damaging Het
Rnf111 A T 9: 70,429,584 C932* probably null Het
Sdc2 T C 15: 33,017,132 Y31H probably damaging Het
Selenoh T C 2: 84,670,331 E55G possibly damaging Het
Serpina3k T G 12: 104,344,192 V327G possibly damaging Het
Setd1b A G 5: 123,148,616 E575G unknown Het
Slco1a4 A T 6: 141,819,540 S325R probably damaging Het
Smtnl1 C A 2: 84,818,443 V156L possibly damaging Het
Tctex1d4 A G 4: 117,128,615 T212A possibly damaging Het
Tmem101 T A 11: 102,155,837 M69L possibly damaging Het
Treh G A 9: 44,685,911 M542I probably benign Het
Trim30b T C 7: 104,357,331 Y106C possibly damaging Het
Ttc6 T C 12: 57,576,655 I280T probably benign Het
Ubtfl1 A G 9: 18,409,493 T106A probably damaging Het
Wdr27 T C 17: 14,903,462 H583R probably benign Het
Xirp2 C T 2: 67,513,897 P2161S probably damaging Het
Other mutations in Speg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Speg APN 1 75410390 missense possibly damaging 0.95
IGL00979:Speg APN 1 75410734 missense probably damaging 0.98
IGL01122:Speg APN 1 75410035 missense probably damaging 1.00
IGL01293:Speg APN 1 75388102 missense probably damaging 1.00
IGL01304:Speg APN 1 75428197 missense probably benign 0.00
IGL01351:Speg APN 1 75411276 splice site probably benign
IGL01473:Speg APN 1 75428285 missense possibly damaging 0.53
IGL01477:Speg APN 1 75391897 missense probably damaging 1.00
IGL01485:Speg APN 1 75387827 missense probably damaging 1.00
IGL01584:Speg APN 1 75430937 missense probably damaging 1.00
IGL01959:Speg APN 1 75391090 missense probably damaging 1.00
IGL02231:Speg APN 1 75423387 missense probably damaging 1.00
IGL02355:Speg APN 1 75423915 missense possibly damaging 0.49
IGL02362:Speg APN 1 75423915 missense possibly damaging 0.49
IGL03013:Speg APN 1 75431279 missense probably damaging 0.97
IGL03168:Speg APN 1 75388187 missense probably damaging 1.00
H8562:Speg UTSW 1 75415597 missense probably benign 0.39
R0112:Speg UTSW 1 75385032 missense possibly damaging 0.92
R0311:Speg UTSW 1 75430937 missense probably damaging 1.00
R0315:Speg UTSW 1 75415136 missense possibly damaging 0.88
R0393:Speg UTSW 1 75423924 missense possibly damaging 0.46
R0403:Speg UTSW 1 75430784 splice site probably benign
R0483:Speg UTSW 1 75385032 missense possibly damaging 0.92
R0648:Speg UTSW 1 75427978 missense probably benign
R0683:Speg UTSW 1 75429118 missense probably damaging 1.00
R0800:Speg UTSW 1 75423489 missense probably damaging 1.00
R0815:Speg UTSW 1 75415392 missense probably damaging 1.00
R0835:Speg UTSW 1 75375674 missense probably benign 0.00
R0866:Speg UTSW 1 75417083 missense probably damaging 0.99
R0880:Speg UTSW 1 75405061 missense probably damaging 1.00
R1082:Speg UTSW 1 75415138 missense possibly damaging 0.94
R1140:Speg UTSW 1 75429095 missense probably damaging 1.00
R1252:Speg UTSW 1 75427095 missense probably damaging 1.00
R1301:Speg UTSW 1 75401501 missense probably damaging 1.00
R1348:Speg UTSW 1 75422872 missense probably damaging 0.99
R1388:Speg UTSW 1 75430460 missense probably damaging 0.99
R1465:Speg UTSW 1 75428484 splice site probably benign
R1505:Speg UTSW 1 75375542 missense probably benign 0.02
R1506:Speg UTSW 1 75417663 missense probably benign 0.03
R1531:Speg UTSW 1 75401222 missense possibly damaging 0.86
R1543:Speg UTSW 1 75421951 missense probably damaging 1.00
R1567:Speg UTSW 1 75428047 missense probably benign
R1630:Speg UTSW 1 75422977 missense probably damaging 1.00
R1667:Speg UTSW 1 75410549 splice site probably benign
R1673:Speg UTSW 1 75411163 missense possibly damaging 0.60
R1718:Speg UTSW 1 75417863 missense probably benign 0.00
R1718:Speg UTSW 1 75421744 missense possibly damaging 0.87
R1719:Speg UTSW 1 75417863 missense probably benign 0.00
R1759:Speg UTSW 1 75401162 missense possibly damaging 0.95
R1861:Speg UTSW 1 75389005 missense probably damaging 1.00
R1874:Speg UTSW 1 75423906 missense probably benign
R1936:Speg UTSW 1 75431408 missense possibly damaging 0.93
R2192:Speg UTSW 1 75417727 missense probably damaging 1.00
R2204:Speg UTSW 1 75430477 missense probably benign 0.30
R2287:Speg UTSW 1 75430465 missense possibly damaging 0.76
R2696:Speg UTSW 1 75406926 missense probably benign 0.27
R2983:Speg UTSW 1 75384930 missense possibly damaging 0.83
R3110:Speg UTSW 1 75422682 nonsense probably null
R3112:Speg UTSW 1 75422682 nonsense probably null
R3154:Speg UTSW 1 75401542 missense probably damaging 1.00
R3720:Speg UTSW 1 75426782 missense probably damaging 1.00
R3983:Speg UTSW 1 75422547 missense probably benign 0.27
R4133:Speg UTSW 1 75427904 missense probably benign
R4522:Speg UTSW 1 75428330 missense probably damaging 1.00
R4564:Speg UTSW 1 75391834 missense probably damaging 1.00
R4858:Speg UTSW 1 75421735 missense probably damaging 1.00
R4953:Speg UTSW 1 75423864 missense possibly damaging 0.72
R4965:Speg UTSW 1 75427703 missense probably damaging 1.00
R4967:Speg UTSW 1 75387869 missense probably damaging 1.00
R5152:Speg UTSW 1 75428098 missense possibly damaging 0.92
R5156:Speg UTSW 1 75428087 missense probably damaging 0.99
R5371:Speg UTSW 1 75431393 missense possibly damaging 0.50
R5550:Speg UTSW 1 75429100 missense probably damaging 1.00
R5562:Speg UTSW 1 75427056 missense probably damaging 1.00
R5687:Speg UTSW 1 75419129 splice site probably null
R5985:Speg UTSW 1 75406684 missense possibly damaging 0.94
R6004:Speg UTSW 1 75415603 nonsense probably null
R6038:Speg UTSW 1 75418459 critical splice donor site probably null
R6038:Speg UTSW 1 75418459 critical splice donor site probably null
R6143:Speg UTSW 1 75414387 missense probably damaging 1.00
R6265:Speg UTSW 1 75406679 nonsense probably null
R6347:Speg UTSW 1 75426875 missense probably benign 0.00
R6453:Speg UTSW 1 75417972 missense probably benign 0.06
R6505:Speg UTSW 1 75406684 missense possibly damaging 0.94
R6505:Speg UTSW 1 75429523 missense possibly damaging 0.93
R6531:Speg UTSW 1 75422757 missense probably benign 0.03
R6566:Speg UTSW 1 75388463 missense probably damaging 1.00
R6747:Speg UTSW 1 75410395 critical splice donor site probably null
R6819:Speg UTSW 1 75391812 missense possibly damaging 0.56
R6821:Speg UTSW 1 75417903 missense possibly damaging 0.83
R6919:Speg UTSW 1 75387908 nonsense probably null
R6981:Speg UTSW 1 75430913 missense probably damaging 1.00
R7002:Speg UTSW 1 75423268 missense probably damaging 0.98
R7082:Speg UTSW 1 75411447 missense probably damaging 0.96
R7140:Speg UTSW 1 75406770 critical splice donor site probably null
R7175:Speg UTSW 1 75422490 missense probably benign 0.01
R7178:Speg UTSW 1 75422383 missense possibly damaging 0.46
R7345:Speg UTSW 1 75384835 missense probably damaging 0.97
R7420:Speg UTSW 1 75430905 missense probably damaging 1.00
R7537:Speg UTSW 1 75401464 missense probably damaging 1.00
R7562:Speg UTSW 1 75431279 missense probably damaging 0.97
R7615:Speg UTSW 1 75429242 missense probably damaging 1.00
R7679:Speg UTSW 1 75406315 missense probably damaging 1.00
R7692:Speg UTSW 1 75401190 missense probably benign 0.04
R7696:Speg UTSW 1 75429161 missense probably damaging 1.00
R7719:Speg UTSW 1 75375825 missense probably damaging 1.00
R7794:Speg UTSW 1 75388870 missense probably benign 0.00
R7824:Speg UTSW 1 75384017 splice site probably null
R7834:Speg UTSW 1 75384927 missense probably damaging 1.00
R7892:Speg UTSW 1 75427166 missense probably damaging 1.00
R8015:Speg UTSW 1 75415421 splice site probably benign
R8068:Speg UTSW 1 75422250 missense probably damaging 1.00
R8085:Speg UTSW 1 75415353 missense probably damaging 1.00
R8130:Speg UTSW 1 75415596 missense probably damaging 1.00
R8132:Speg UTSW 1 75422995 missense probably damaging 1.00
R8239:Speg UTSW 1 75419033 missense probably damaging 1.00
R8287:Speg UTSW 1 75422236 missense probably benign 0.26
R8299:Speg UTSW 1 75387836 missense possibly damaging 0.95
R8441:Speg UTSW 1 75411332 missense possibly damaging 0.60
R8468:Speg UTSW 1 75431309 missense probably damaging 1.00
R8555:Speg UTSW 1 75402264 splice site probably null
R8781:Speg UTSW 1 75407021 missense probably damaging 1.00
R8784:Speg UTSW 1 75405149 critical splice donor site probably benign
R8848:Speg UTSW 1 75427438 critical splice donor site probably null
R8881:Speg UTSW 1 75401151 missense possibly damaging 0.67
R8898:Speg UTSW 1 75388873 missense probably damaging 1.00
R8935:Speg UTSW 1 75422606 missense probably benign 0.30
R9019:Speg UTSW 1 75429238 missense probably damaging 1.00
R9027:Speg UTSW 1 75388432 missense possibly damaging 0.67
R9066:Speg UTSW 1 75385010 missense probably damaging 0.99
R9092:Speg UTSW 1 75422734 missense probably benign 0.01
R9117:Speg UTSW 1 75387800 missense probably damaging 1.00
R9202:Speg UTSW 1 75390993 missense probably damaging 1.00
R9246:Speg UTSW 1 75384854 missense probably damaging 1.00
R9248:Speg UTSW 1 75421776 missense probably damaging 1.00
R9451:Speg UTSW 1 75417733 missense probably damaging 1.00
R9452:Speg UTSW 1 75422508 missense probably benign
R9475:Speg UTSW 1 75388091 missense probably damaging 1.00
R9476:Speg UTSW 1 75401124 missense probably damaging 0.99
R9510:Speg UTSW 1 75401124 missense probably damaging 0.99
R9519:Speg UTSW 1 75415736 missense probably damaging 1.00
R9528:Speg UTSW 1 75387803 missense possibly damaging 0.78
R9542:Speg UTSW 1 75422782 missense probably benign 0.08
R9553:Speg UTSW 1 75418001 missense probably benign 0.00
X0025:Speg UTSW 1 75422457 missense probably damaging 1.00
X0026:Speg UTSW 1 75423475 missense possibly damaging 0.88
Z1176:Speg UTSW 1 75406594 missense probably damaging 1.00
Z1177:Speg UTSW 1 75427683 missense probably damaging 1.00
Z1177:Speg UTSW 1 75428381 missense probably damaging 1.00
Z1177:Speg UTSW 1 75430455 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCGTGTTCTGGGGAGAAGAGAC -3'
(R):5'- AACTTGGCTGCAAACTCCAG -3'

Sequencing Primer
(F):5'- AGTATCCTGCCCGGTTCC -3'
(R):5'- TGCAAACTCCAGGCCAGAG -3'
Posted On 2015-09-24