Incidental Mutation 'R4577:Selenoh'
ID342523
Institutional Source Beutler Lab
Gene Symbol Selenoh
Ensembl Gene ENSMUSG00000076437
Gene Nameselenoprotein H
Synonyms2700094K13Rik, SelH
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock #R4577 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location84669215-84670770 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 84670331 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 55 (E55G)
Ref Sequence ENSEMBL: ENSMUSP00000139492 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053664] [ENSMUST00000102646] [ENSMUST00000102647] [ENSMUST00000111664] [ENSMUST00000111665] [ENSMUST00000117299] [ENSMUST00000133437] [ENSMUST00000189636] [ENSMUST00000189772] [ENSMUST00000189988]
Predicted Effect probably benign
Transcript: ENSMUST00000053664
SMART Domains Protein: ENSMUSP00000059582
Gene: ENSMUSG00000050043

DomainStartEndE-ValueType
transmembrane domain 20 39 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
Pfam:Thioredoxin 137 243 3.6e-13 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000102646
AA Change: E55G

PolyPhen 2 Score 0.728 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000099706
Gene: ENSMUSG00000076437
AA Change: E55G

DomainStartEndE-ValueType
Pfam:Rdx 28 114 2.4e-14 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000102647
AA Change: E55G

PolyPhen 2 Score 0.728 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000099707
Gene: ENSMUSG00000076437
AA Change: E55G

DomainStartEndE-ValueType
Pfam:Rdx 28 114 2.4e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111664
SMART Domains Protein: ENSMUSP00000107293
Gene: ENSMUSG00000050043

DomainStartEndE-ValueType
low complexity region 27 38 N/A INTRINSIC
Pfam:Thioredoxin 99 205 1.6e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111665
SMART Domains Protein: ENSMUSP00000107294
Gene: ENSMUSG00000050043

DomainStartEndE-ValueType
transmembrane domain 20 39 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
Pfam:Thioredoxin 137 243 3.3e-13 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000117299
AA Change: E55G

PolyPhen 2 Score 0.728 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000112635
Gene: ENSMUSG00000076437
AA Change: E55G

DomainStartEndE-ValueType
Pfam:Rdx 28 114 2.4e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123772
Predicted Effect probably benign
Transcript: ENSMUST00000133437
SMART Domains Protein: ENSMUSP00000142247
Gene: ENSMUSG00000086598

DomainStartEndE-ValueType
BTB 34 132 4.96e-11 SMART
low complexity region 217 230 N/A INTRINSIC
low complexity region 271 286 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138529
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154179
Predicted Effect probably benign
Transcript: ENSMUST00000189636
AA Change: E55G

PolyPhen 2 Score 0.098 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000139830
Gene: ENSMUSG00000076437
AA Change: E55G

DomainStartEndE-ValueType
Pfam:Rdx 28 109 1.7e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000189772
SMART Domains Protein: ENSMUSP00000141166
Gene: ENSMUSG00000101645

DomainStartEndE-ValueType
coiled coil region 10 45 N/A INTRINSIC
low complexity region 126 153 N/A INTRINSIC
ARM 397 437 2.53e-6 SMART
ARM 440 481 2.8e-8 SMART
ARM 482 539 6.3e1 SMART
ARM 541 588 3.74e0 SMART
Blast:ARM 651 693 9e-20 BLAST
ARM 699 739 1.23e-4 SMART
ARM 789 831 4.41e1 SMART
low complexity region 857 868 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000189988
AA Change: E55G

PolyPhen 2 Score 0.832 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000139492
Gene: ENSMUSG00000076437
AA Change: E55G

DomainStartEndE-ValueType
Pfam:Rdx 28 96 1e-6 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a nucleolar protein, which belongs to the SelWTH family. It functions as an oxidoreductase, and has been shown to protect neurons against UVB-induced damage by inhibiting apoptotic cell death pathways, promote mitochondrial biogenesis and mitochondrial function, and suppress cellular senescence through genome maintenance and redox regulation. This protein is a selenoprotein, containing the rare amino acid selenocysteine (Sec) at its active site. Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, May 2016]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430531B16Rik A G 7: 139,978,130 I51T probably damaging Het
Abca1 C A 4: 53,062,568 C1429F possibly damaging Het
Acacb A G 5: 114,226,831 E1524G probably damaging Het
Ankrd50 A G 3: 38,455,941 V759A probably damaging Het
Ano9 T C 7: 141,104,138 Q538R probably damaging Het
Bnip2 A G 9: 69,997,162 D67G probably benign Het
Cacna1e A T 1: 154,402,027 S2060T possibly damaging Het
Cand2 G A 6: 115,791,259 C455Y probably damaging Het
Cdh16 T C 8: 104,618,559 D366G probably damaging Het
Cep170b A G 12: 112,744,718 R595G probably damaging Het
Chaf1a G A 17: 56,065,184 R784Q probably damaging Het
Clca4a C A 3: 144,954,969 S698I probably damaging Het
Dnah5 A C 15: 28,289,250 Y1195S probably benign Het
Dysf T C 6: 84,137,326 I1229T probably damaging Het
Eef2 GCCC GCCCC 10: 81,178,767 probably null Het
Ep300 T C 15: 81,649,009 S1756P unknown Het
Ep300 T A 15: 81,611,410 probably benign Het
F3 A G 3: 121,734,114 I254V probably benign Het
Fam166a T C 2: 25,220,288 S71P probably benign Het
Frmd4a C A 2: 4,603,679 A786E possibly damaging Het
Fsd1l T C 4: 53,686,397 F270S probably damaging Het
Galnt3 T C 2: 66,097,859 Y231C probably benign Het
Gm10220 A C 5: 26,117,871 I181S probably benign Het
Gm13178 A C 4: 144,703,753 I222S probably damaging Het
Gnb5 G A 9: 75,343,541 V316I possibly damaging Het
Gys2 A G 6: 142,454,510 F325S possibly damaging Het
Hmgn2 G A 4: 133,967,357 probably benign Het
Hsph1 A G 5: 149,618,843 V705A probably benign Het
Ighg2b T C 12: 113,306,892 E206G unknown Het
Iqub A T 6: 24,501,291 I220N probably damaging Het
Jmjd1c A G 10: 67,249,750 T2259A probably damaging Het
Kcnq3 T C 15: 66,286,214 K4R unknown Het
Klk12 A G 7: 43,773,243 D198G probably damaging Het
L3mbtl2 G A 15: 81,686,285 E655K probably benign Het
Lrp1b C T 2: 40,821,719 C3163Y probably damaging Het
Map3k19 T A 1: 127,822,813 R934* probably null Het
Map4 A G 9: 110,081,421 T1061A possibly damaging Het
Mbnl1 G A 3: 60,529,778 V50I probably damaging Het
Med15 G A 16: 17,674,515 Q132* probably null Het
Mef2a T C 7: 67,240,439 N131S probably benign Het
Mtmr3 G C 11: 4,497,375 L361V probably damaging Het
Myo5a A G 9: 75,217,545 E1792G probably damaging Het
Nup88 C A 11: 70,969,717 A55S probably damaging Het
Olfr1252 T C 2: 89,722,043 K23E possibly damaging Het
Olfr374 T A 8: 72,110,323 Y252* probably null Het
Pacs1 G T 19: 5,143,833 S556* probably null Het
Parp4 A G 14: 56,590,410 E206G probably benign Het
Paxbp1 T G 16: 91,015,154 K889N probably damaging Het
Pcdhga2 G A 18: 37,669,249 A49T possibly damaging Het
Pcsk6 T A 7: 65,959,266 L292* probably null Het
Plb1 C T 5: 32,247,557 Q20* probably null Het
Plec C A 15: 76,184,069 Q1142H possibly damaging Het
Pnpla2 T C 7: 141,457,344 S87P probably damaging Het
Prss28 T C 17: 25,310,105 V140A probably damaging Het
Rad17 A T 13: 100,633,278 S258T probably damaging Het
Rnf111 A T 9: 70,429,584 C932* probably null Het
Sdc2 T C 15: 33,017,132 Y31H probably damaging Het
Serpina3k T G 12: 104,344,192 V327G possibly damaging Het
Setd1b A G 5: 123,148,616 E575G unknown Het
Slco1a4 A T 6: 141,819,540 S325R probably damaging Het
Smtnl1 C A 2: 84,818,443 V156L possibly damaging Het
Speg A G 1: 75,415,395 D1607G probably damaging Het
Tctex1d4 A G 4: 117,128,615 T212A possibly damaging Het
Tmem101 T A 11: 102,155,837 M69L possibly damaging Het
Treh G A 9: 44,685,911 M542I probably benign Het
Trim30b T C 7: 104,357,331 Y106C possibly damaging Het
Ttc6 T C 12: 57,576,655 I280T probably benign Het
Ubtfl1 A G 9: 18,409,493 T106A probably damaging Het
Wdr27 T C 17: 14,903,462 H583R probably benign Het
Xirp2 C T 2: 67,513,897 P2161S probably damaging Het
Other mutations in Selenoh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01373:Selenoh APN 2 84670594 utr 5 prime probably benign
R7271:Selenoh UTSW 2 84670287 missense probably damaging 1.00
R7655:Selenoh UTSW 2 84670380 missense probably damaging 1.00
R7656:Selenoh UTSW 2 84670380 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCCAGAGTTCAACACCTGG -3'
(R):5'- ACCGTGGTCATTGAGCATTGG -3'

Sequencing Primer
(F):5'- CCAAATTATGGTGGTACTCATTGG -3'
(R):5'- CATTGAGCATTGGTGAGGGG -3'
Posted On2015-09-24