Incidental Mutation 'R4577:Smtnl1'
ID342524
Institutional Source Beutler Lab
Gene Symbol Smtnl1
Ensembl Gene ENSMUSG00000027077
Gene Namesmoothelin-like 1
SynonymsChasm, 1110030K22Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4577 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location84811176-84822652 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 84818443 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 156 (V156L)
Ref Sequence ENSEMBL: ENSMUSP00000028471 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028471]
PDB Structure
The Solution Structure of Calponin Homology Domain from Smoothelin-like 1 [SOLUTION NMR]
HADDOCK-derived structure of the CH-domain of the smoothelin-like 1 complexed with the C-domain of apocalmodulin [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028471
AA Change: V156L

PolyPhen 2 Score 0.505 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000028471
Gene: ENSMUSG00000027077
AA Change: V156L

DomainStartEndE-ValueType
low complexity region 56 72 N/A INTRINSIC
coiled coil region 124 154 N/A INTRINSIC
low complexity region 218 230 N/A INTRINSIC
low complexity region 236 246 N/A INTRINSIC
low complexity region 260 285 N/A INTRINSIC
CH 345 444 5.55e-18 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in the contraction of both striated and smooth muscle. During pregnancy, the encoded protein interacts with progesterone receptor to attenuate the expression of contractile and metabolic proteins. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a null allele exhibit vascular and muscular adaptations normally found in exercised animals as well as increased exercise endurance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430531B16Rik A G 7: 139,978,130 I51T probably damaging Het
Abca1 C A 4: 53,062,568 C1429F possibly damaging Het
Acacb A G 5: 114,226,831 E1524G probably damaging Het
Ankrd50 A G 3: 38,455,941 V759A probably damaging Het
Ano9 T C 7: 141,104,138 Q538R probably damaging Het
Bnip2 A G 9: 69,997,162 D67G probably benign Het
Cacna1e A T 1: 154,402,027 S2060T possibly damaging Het
Cand2 G A 6: 115,791,259 C455Y probably damaging Het
Cdh16 T C 8: 104,618,559 D366G probably damaging Het
Cep170b A G 12: 112,744,718 R595G probably damaging Het
Chaf1a G A 17: 56,065,184 R784Q probably damaging Het
Clca4a C A 3: 144,954,969 S698I probably damaging Het
Dnah5 A C 15: 28,289,250 Y1195S probably benign Het
Dysf T C 6: 84,137,326 I1229T probably damaging Het
Eef2 GCCC GCCCC 10: 81,178,767 probably null Het
Ep300 T C 15: 81,649,009 S1756P unknown Het
Ep300 T A 15: 81,611,410 probably benign Het
F3 A G 3: 121,734,114 I254V probably benign Het
Fam166a T C 2: 25,220,288 S71P probably benign Het
Frmd4a C A 2: 4,603,679 A786E possibly damaging Het
Fsd1l T C 4: 53,686,397 F270S probably damaging Het
Galnt3 T C 2: 66,097,859 Y231C probably benign Het
Gm10220 A C 5: 26,117,871 I181S probably benign Het
Gm13178 A C 4: 144,703,753 I222S probably damaging Het
Gnb5 G A 9: 75,343,541 V316I possibly damaging Het
Gys2 A G 6: 142,454,510 F325S possibly damaging Het
Hmgn2 G A 4: 133,967,357 probably benign Het
Hsph1 A G 5: 149,618,843 V705A probably benign Het
Ighg2b T C 12: 113,306,892 E206G unknown Het
Iqub A T 6: 24,501,291 I220N probably damaging Het
Jmjd1c A G 10: 67,249,750 T2259A probably damaging Het
Kcnq3 T C 15: 66,286,214 K4R unknown Het
Klk12 A G 7: 43,773,243 D198G probably damaging Het
L3mbtl2 G A 15: 81,686,285 E655K probably benign Het
Lrp1b C T 2: 40,821,719 C3163Y probably damaging Het
Map3k19 T A 1: 127,822,813 R934* probably null Het
Map4 A G 9: 110,081,421 T1061A possibly damaging Het
Mbnl1 G A 3: 60,529,778 V50I probably damaging Het
Med15 G A 16: 17,674,515 Q132* probably null Het
Mef2a T C 7: 67,240,439 N131S probably benign Het
Mtmr3 G C 11: 4,497,375 L361V probably damaging Het
Myo5a A G 9: 75,217,545 E1792G probably damaging Het
Nup88 C A 11: 70,969,717 A55S probably damaging Het
Olfr1252 T C 2: 89,722,043 K23E possibly damaging Het
Olfr374 T A 8: 72,110,323 Y252* probably null Het
Pacs1 G T 19: 5,143,833 S556* probably null Het
Parp4 A G 14: 56,590,410 E206G probably benign Het
Paxbp1 T G 16: 91,015,154 K889N probably damaging Het
Pcdhga2 G A 18: 37,669,249 A49T possibly damaging Het
Pcsk6 T A 7: 65,959,266 L292* probably null Het
Plb1 C T 5: 32,247,557 Q20* probably null Het
Plec C A 15: 76,184,069 Q1142H possibly damaging Het
Pnpla2 T C 7: 141,457,344 S87P probably damaging Het
Prss28 T C 17: 25,310,105 V140A probably damaging Het
Rad17 A T 13: 100,633,278 S258T probably damaging Het
Rnf111 A T 9: 70,429,584 C932* probably null Het
Sdc2 T C 15: 33,017,132 Y31H probably damaging Het
Selenoh T C 2: 84,670,331 E55G possibly damaging Het
Serpina3k T G 12: 104,344,192 V327G possibly damaging Het
Setd1b A G 5: 123,148,616 E575G unknown Het
Slco1a4 A T 6: 141,819,540 S325R probably damaging Het
Speg A G 1: 75,415,395 D1607G probably damaging Het
Tctex1d4 A G 4: 117,128,615 T212A possibly damaging Het
Tmem101 T A 11: 102,155,837 M69L possibly damaging Het
Treh G A 9: 44,685,911 M542I probably benign Het
Trim30b T C 7: 104,357,331 Y106C possibly damaging Het
Ttc6 T C 12: 57,576,655 I280T probably benign Het
Ubtfl1 A G 9: 18,409,493 T106A probably damaging Het
Wdr27 T C 17: 14,903,462 H583R probably benign Het
Xirp2 C T 2: 67,513,897 P2161S probably damaging Het
Other mutations in Smtnl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01135:Smtnl1 APN 2 84818887 missense probably benign
IGL01702:Smtnl1 APN 2 84818690 missense possibly damaging 0.71
IGL01836:Smtnl1 APN 2 84815370 missense probably damaging 1.00
IGL01866:Smtnl1 APN 2 84818745 missense possibly damaging 0.80
IGL01869:Smtnl1 APN 2 84811397 makesense probably null
IGL01989:Smtnl1 APN 2 84818470 missense probably benign 0.22
IGL02247:Smtnl1 APN 2 84817028 splice site probably benign
R1442:Smtnl1 UTSW 2 84818436 missense probably damaging 0.97
R5340:Smtnl1 UTSW 2 84815441 missense probably damaging 1.00
R5524:Smtnl1 UTSW 2 84818894 missense probably benign 0.05
R5561:Smtnl1 UTSW 2 84818395 missense probably benign 0.31
R5631:Smtnl1 UTSW 2 84818754 missense probably benign
R5997:Smtnl1 UTSW 2 84815378 missense probably damaging 1.00
R6050:Smtnl1 UTSW 2 84811453 missense probably damaging 1.00
R6433:Smtnl1 UTSW 2 84818368 missense probably benign 0.03
R7011:Smtnl1 UTSW 2 84818409 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTGGAGGCCTTACTCACCAC -3'
(R):5'- AGCAGCATCTAAGAGTGGCG -3'

Sequencing Primer
(F):5'- ACTCACCACCAACTCCTTTGTG -3'
(R):5'- GCAAGTATATTAGATGAGCTCAAGAC -3'
Posted On2015-09-24