Incidental Mutation 'R4577:Ankrd50'
ID342527
Institutional Source Beutler Lab
Gene Symbol Ankrd50
Ensembl Gene ENSMUSG00000044864
Gene Nameankyrin repeat domain 50
SynonymsE430012K20Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.651) question?
Stock #R4577 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location38449259-38484844 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 38455941 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 759 (V759A)
Ref Sequence ENSEMBL: ENSMUSP00000122842 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094300] [ENSMUST00000120875] [ENSMUST00000156038]
Predicted Effect probably benign
Transcript: ENSMUST00000094300
SMART Domains Protein: ENSMUSP00000091858
Gene: ENSMUSG00000044864

DomainStartEndE-ValueType
ANK 18 47 1.16e-5 SMART
ANK 51 80 3.41e-3 SMART
ANK 84 113 2.9e-6 SMART
ANK 117 147 3.31e-1 SMART
low complexity region 216 243 N/A INTRINSIC
low complexity region 262 282 N/A INTRINSIC
low complexity region 301 332 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120875
SMART Domains Protein: ENSMUSP00000113349
Gene: ENSMUSG00000044864

DomainStartEndE-ValueType
SCOP:d1kaga_ 72 90 4e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000156038
AA Change: V759A

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000122842
Gene: ENSMUSG00000044864
AA Change: V759A

DomainStartEndE-ValueType
Blast:ANK 440 472 8e-11 BLAST
ANK 507 536 7.95e-4 SMART
ANK 540 569 1.01e-5 SMART
ANK 573 602 6.81e-3 SMART
ANK 606 635 1.7e-3 SMART
ANK 639 668 7.64e-6 SMART
ANK 672 706 4.5e-3 SMART
ANK 710 739 3.33e-6 SMART
ANK 743 772 5.37e-1 SMART
ANK 776 806 1.65e-1 SMART
ANK 809 838 1.2e-3 SMART
ANK 842 871 3.97e-4 SMART
ANK 875 904 3.06e-5 SMART
ANK 908 937 2.88e-1 SMART
ANK 941 970 1.16e-5 SMART
ANK 974 1003 3.41e-3 SMART
ANK 1007 1036 2.9e-6 SMART
ANK 1040 1070 3.31e-1 SMART
low complexity region 1139 1166 N/A INTRINSIC
low complexity region 1185 1205 N/A INTRINSIC
low complexity region 1224 1255 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430531B16Rik A G 7: 139,978,130 I51T probably damaging Het
Abca1 C A 4: 53,062,568 C1429F possibly damaging Het
Acacb A G 5: 114,226,831 E1524G probably damaging Het
Ano9 T C 7: 141,104,138 Q538R probably damaging Het
Bnip2 A G 9: 69,997,162 D67G probably benign Het
Cacna1e A T 1: 154,402,027 S2060T possibly damaging Het
Cand2 G A 6: 115,791,259 C455Y probably damaging Het
Cdh16 T C 8: 104,618,559 D366G probably damaging Het
Cep170b A G 12: 112,744,718 R595G probably damaging Het
Chaf1a G A 17: 56,065,184 R784Q probably damaging Het
Clca4a C A 3: 144,954,969 S698I probably damaging Het
Dnah5 A C 15: 28,289,250 Y1195S probably benign Het
Dysf T C 6: 84,137,326 I1229T probably damaging Het
Eef2 GCCC GCCCC 10: 81,178,767 probably null Het
Ep300 T C 15: 81,649,009 S1756P unknown Het
Ep300 T A 15: 81,611,410 probably benign Het
F3 A G 3: 121,734,114 I254V probably benign Het
Fam166a T C 2: 25,220,288 S71P probably benign Het
Frmd4a C A 2: 4,603,679 A786E possibly damaging Het
Fsd1l T C 4: 53,686,397 F270S probably damaging Het
Galnt3 T C 2: 66,097,859 Y231C probably benign Het
Gm10220 A C 5: 26,117,871 I181S probably benign Het
Gm13178 A C 4: 144,703,753 I222S probably damaging Het
Gnb5 G A 9: 75,343,541 V316I possibly damaging Het
Gys2 A G 6: 142,454,510 F325S possibly damaging Het
Hmgn2 G A 4: 133,967,357 probably benign Het
Hsph1 A G 5: 149,618,843 V705A probably benign Het
Ighg2b T C 12: 113,306,892 E206G unknown Het
Iqub A T 6: 24,501,291 I220N probably damaging Het
Jmjd1c A G 10: 67,249,750 T2259A probably damaging Het
Kcnq3 T C 15: 66,286,214 K4R unknown Het
Klk12 A G 7: 43,773,243 D198G probably damaging Het
L3mbtl2 G A 15: 81,686,285 E655K probably benign Het
Lrp1b C T 2: 40,821,719 C3163Y probably damaging Het
Map3k19 T A 1: 127,822,813 R934* probably null Het
Map4 A G 9: 110,081,421 T1061A possibly damaging Het
Mbnl1 G A 3: 60,529,778 V50I probably damaging Het
Med15 G A 16: 17,674,515 Q132* probably null Het
Mef2a T C 7: 67,240,439 N131S probably benign Het
Mtmr3 G C 11: 4,497,375 L361V probably damaging Het
Myo5a A G 9: 75,217,545 E1792G probably damaging Het
Nup88 C A 11: 70,969,717 A55S probably damaging Het
Olfr1252 T C 2: 89,722,043 K23E possibly damaging Het
Olfr374 T A 8: 72,110,323 Y252* probably null Het
Pacs1 G T 19: 5,143,833 S556* probably null Het
Parp4 A G 14: 56,590,410 E206G probably benign Het
Paxbp1 T G 16: 91,015,154 K889N probably damaging Het
Pcdhga2 G A 18: 37,669,249 A49T possibly damaging Het
Pcsk6 T A 7: 65,959,266 L292* probably null Het
Plb1 C T 5: 32,247,557 Q20* probably null Het
Plec C A 15: 76,184,069 Q1142H possibly damaging Het
Pnpla2 T C 7: 141,457,344 S87P probably damaging Het
Prss28 T C 17: 25,310,105 V140A probably damaging Het
Rad17 A T 13: 100,633,278 S258T probably damaging Het
Rnf111 A T 9: 70,429,584 C932* probably null Het
Sdc2 T C 15: 33,017,132 Y31H probably damaging Het
Selenoh T C 2: 84,670,331 E55G possibly damaging Het
Serpina3k T G 12: 104,344,192 V327G possibly damaging Het
Setd1b A G 5: 123,148,616 E575G unknown Het
Slco1a4 A T 6: 141,819,540 S325R probably damaging Het
Smtnl1 C A 2: 84,818,443 V156L possibly damaging Het
Speg A G 1: 75,415,395 D1607G probably damaging Het
Tctex1d4 A G 4: 117,128,615 T212A possibly damaging Het
Tmem101 T A 11: 102,155,837 M69L possibly damaging Het
Treh G A 9: 44,685,911 M542I probably benign Het
Trim30b T C 7: 104,357,331 Y106C possibly damaging Het
Ttc6 T C 12: 57,576,655 I280T probably benign Het
Ubtfl1 A G 9: 18,409,493 T106A probably damaging Het
Wdr27 T C 17: 14,903,462 H583R probably benign Het
Xirp2 C T 2: 67,513,897 P2161S probably damaging Het
Other mutations in Ankrd50
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Ankrd50 APN 3 38452414 utr 3 prime probably benign
PIT4378001:Ankrd50 UTSW 3 38455263 missense possibly damaging 0.94
PIT4434001:Ankrd50 UTSW 3 38455263 missense possibly damaging 0.94
PIT4651001:Ankrd50 UTSW 3 38455810 nonsense probably null
R0048:Ankrd50 UTSW 3 38483049 missense probably benign 0.00
R0048:Ankrd50 UTSW 3 38483049 missense probably benign 0.00
R0127:Ankrd50 UTSW 3 38456235 missense probably benign 0.00
R0179:Ankrd50 UTSW 3 38455314 missense possibly damaging 0.61
R0417:Ankrd50 UTSW 3 38456361 missense probably damaging 1.00
R0593:Ankrd50 UTSW 3 38483007 nonsense probably null
R1076:Ankrd50 UTSW 3 38454922 missense probably damaging 0.97
R1127:Ankrd50 UTSW 3 38457187 missense probably benign 0.02
R1169:Ankrd50 UTSW 3 38454252 missense probably damaging 1.00
R1212:Ankrd50 UTSW 3 38455687 missense probably damaging 1.00
R1447:Ankrd50 UTSW 3 38455542 missense probably damaging 1.00
R1864:Ankrd50 UTSW 3 38454461 missense probably benign 0.02
R1900:Ankrd50 UTSW 3 38455387 missense probably damaging 1.00
R1907:Ankrd50 UTSW 3 38454052 missense probably damaging 1.00
R1912:Ankrd50 UTSW 3 38456776 missense probably benign 0.07
R2051:Ankrd50 UTSW 3 38454493 missense probably benign 0.21
R2197:Ankrd50 UTSW 3 38455592 missense probably damaging 1.00
R2403:Ankrd50 UTSW 3 38483085 nonsense probably null
R3716:Ankrd50 UTSW 3 38454150 missense probably damaging 0.99
R3944:Ankrd50 UTSW 3 38452496 missense probably benign 0.03
R3948:Ankrd50 UTSW 3 38482841 missense possibly damaging 0.75
R4483:Ankrd50 UTSW 3 38457531 missense probably damaging 1.00
R4691:Ankrd50 UTSW 3 38483010 missense probably benign 0.01
R4907:Ankrd50 UTSW 3 38454973 nonsense probably null
R4907:Ankrd50 UTSW 3 38456675 missense probably damaging 0.98
R5135:Ankrd50 UTSW 3 38455803 missense probably damaging 1.00
R5356:Ankrd50 UTSW 3 38456185 missense probably damaging 0.99
R5368:Ankrd50 UTSW 3 38455050 missense probably damaging 1.00
R5534:Ankrd50 UTSW 3 38456082 missense probably damaging 0.99
R6103:Ankrd50 UTSW 3 38454429 missense probably damaging 0.99
R6169:Ankrd50 UTSW 3 38455839 missense probably damaging 1.00
R6653:Ankrd50 UTSW 3 38457361 missense probably damaging 1.00
R7317:Ankrd50 UTSW 3 38483183 missense possibly damaging 0.90
R7469:Ankrd50 UTSW 3 38454193 missense probably damaging 0.99
R7617:Ankrd50 UTSW 3 38484682 unclassified probably benign
R7749:Ankrd50 UTSW 3 38482721 missense probably damaging 1.00
Z1088:Ankrd50 UTSW 3 38457165 missense probably damaging 0.96
Z1177:Ankrd50 UTSW 3 38455792 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTAGCACCTTGTTCAATGAGAGC -3'
(R):5'- GGCTGAGGTAGATCACTGTG -3'

Sequencing Primer
(F):5'- CTCAAAAGCTGCCATGTGTAG -3'
(R):5'- TGACAAGGATGGCATGACCCC -3'
Posted On2015-09-24