Mutagenetix > Incidental Mutation

Incidental Mutation 'R4577:Abca1'

342531

Institutional Source

Beutler Lab

Gene Symbol

Abca1

Ensembl Gene

ENSMUSG00000015243

Gene Name

ATP-binding cassette, sub-family A (ABC1), member 1

Synonyms

ABC1

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4577 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

53030787-53159895 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 53062568 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Phenylalanine at position 1429 (C1429F)

Ref Sequence

ENSEMBL: ENSMUSP00000030010 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030010]

AlphaFold

P41233

Predicted Effect

possibly damaging
Transcript: ENSMUST00000030010
AA Change: C1429F

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000030010
Gene: ENSMUSG00000015243
AA Change: C1429F

Domain	Start	End	E-Value	Type
transmembrane domain	25	47	N/A	INTRINSIC
Pfam:ABC2_membrane_3	395	841	4.9e-14	PFAM
AAA	925	1122	4.2e-10	SMART
low complexity region	1137	1150	N/A	INTRINSIC
Pfam:ABC2_membrane_3	1344	1869	1.7e-53	PFAM
low complexity region	1890	1899	N/A	INTRINSIC
AAA	1938	2123	3.04e-7	SMART
low complexity region	2176	2187	N/A	INTRINSIC
low complexity region	2222	2237	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.5%

Validation Efficiency

MGI Phenotype

FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. In humans, this protein functions as a cholesterol efflux pump in the cellular lipid removal pathway. Mutations in the human gene have been associated with Tangier's disease and familial high-density lipoprotein deficiency. [provided by RefSeq, Jul 2008]
PHENOTYPE: Many homozygous null mutants die perinatally with placental defects. Survivors show altered steroidogenesis, defective lipid export in Golgi, low serum cholesterol, lipid accumulation in macrophages and lung, reduced fertility and kidney and heart defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6430531B16Rik	A	G	7: 139,978,130	I51T	probably damaging	Het
Acacb	A	G	5: 114,226,831	E1524G	probably damaging	Het
Ankrd50	A	G	3: 38,455,941	V759A	probably damaging	Het
Ano9	T	C	7: 141,104,138	Q538R	probably damaging	Het
Bnip2	A	G	9: 69,997,162	D67G	probably benign	Het
Cacna1e	A	T	1: 154,402,027	S2060T	possibly damaging	Het
Cand2	G	A	6: 115,791,259	C455Y	probably damaging	Het
Cdh16	T	C	8: 104,618,559	D366G	probably damaging	Het
Cep170b	A	G	12: 112,744,718	R595G	probably damaging	Het
Chaf1a	G	A	17: 56,065,184	R784Q	probably damaging	Het
Clca4a	C	A	3: 144,954,969	S698I	probably damaging	Het
Dnah5	A	C	15: 28,289,250	Y1195S	probably benign	Het
Dysf	T	C	6: 84,137,326	I1229T	probably damaging	Het
Eef2	GCCC	GCCCC	10: 81,178,767		probably null	Het
Ep300	T	C	15: 81,649,009	S1756P	unknown	Het
Ep300	T	A	15: 81,611,410		probably benign	Het
F3	A	G	3: 121,734,114	I254V	probably benign	Het
Fam166a	T	C	2: 25,220,288	S71P	probably benign	Het
Frmd4a	C	A	2: 4,603,679	A786E	possibly damaging	Het
Fsd1l	T	C	4: 53,686,397	F270S	probably damaging	Het
Galnt3	T	C	2: 66,097,859	Y231C	probably benign	Het
Gm10220	A	C	5: 26,117,871	I181S	probably benign	Het
Gm13178	A	C	4: 144,703,753	I222S	probably damaging	Het
Gnb5	G	A	9: 75,343,541	V316I	possibly damaging	Het
Gys2	A	G	6: 142,454,510	F325S	possibly damaging	Het
Hmgn2	G	A	4: 133,967,357		probably benign	Het
Hsph1	A	G	5: 149,618,843	V705A	probably benign	Het
Ighg2b	T	C	12: 113,306,892	E206G	unknown	Het
Iqub	A	T	6: 24,501,291	I220N	probably damaging	Het
Jmjd1c	A	G	10: 67,249,750	T2259A	probably damaging	Het
Kcnq3	T	C	15: 66,286,214	K4R	unknown	Het
Klk12	A	G	7: 43,773,243	D198G	probably damaging	Het
L3mbtl2	G	A	15: 81,686,285	E655K	probably benign	Het
Lrp1b	C	T	2: 40,821,719	C3163Y	probably damaging	Het
Map3k19	T	A	1: 127,822,813	R934*	probably null	Het
Map4	A	G	9: 110,081,421	T1061A	possibly damaging	Het
Mbnl1	G	A	3: 60,529,778	V50I	probably damaging	Het
Med15	G	A	16: 17,674,515	Q132*	probably null	Het
Mef2a	T	C	7: 67,240,439	N131S	probably benign	Het
Mtmr3	G	C	11: 4,497,375	L361V	probably damaging	Het
Myo5a	A	G	9: 75,217,545	E1792G	probably damaging	Het
Nup88	C	A	11: 70,969,717	A55S	probably damaging	Het
Olfr1252	T	C	2: 89,722,043	K23E	possibly damaging	Het
Olfr374	T	A	8: 72,110,323	Y252*	probably null	Het
Pacs1	G	T	19: 5,143,833	S556*	probably null	Het
Parp4	A	G	14: 56,590,410	E206G	probably benign	Het
Paxbp1	T	G	16: 91,015,154	K889N	probably damaging	Het
Pcdhga2	G	A	18: 37,669,249	A49T	possibly damaging	Het
Pcsk6	T	A	7: 65,959,266	L292*	probably null	Het
Plb1	C	T	5: 32,247,557	Q20*	probably null	Het
Plec	C	A	15: 76,184,069	Q1142H	possibly damaging	Het
Pnpla2	T	C	7: 141,457,344	S87P	probably damaging	Het
Prss28	T	C	17: 25,310,105	V140A	probably damaging	Het
Rad17	A	T	13: 100,633,278	S258T	probably damaging	Het
Rnf111	A	T	9: 70,429,584	C932*	probably null	Het
Sdc2	T	C	15: 33,017,132	Y31H	probably damaging	Het
Selenoh	T	C	2: 84,670,331	E55G	possibly damaging	Het
Serpina3k	T	G	12: 104,344,192	V327G	possibly damaging	Het
Setd1b	A	G	5: 123,148,616	E575G	unknown	Het
Slco1a4	A	T	6: 141,819,540	S325R	probably damaging	Het
Smtnl1	C	A	2: 84,818,443	V156L	possibly damaging	Het
Speg	A	G	1: 75,415,395	D1607G	probably damaging	Het
Tctex1d4	A	G	4: 117,128,615	T212A	possibly damaging	Het
Tmem101	T	A	11: 102,155,837	M69L	possibly damaging	Het
Treh	G	A	9: 44,685,911	M542I	probably benign	Het
Trim30b	T	C	7: 104,357,331	Y106C	possibly damaging	Het
Ttc6	T	C	12: 57,576,655	I280T	probably benign	Het
Ubtfl1	A	G	9: 18,409,493	T106A	probably damaging	Het
Wdr27	T	C	17: 14,903,462	H583R	probably benign	Het
Xirp2	C	T	2: 67,513,897	P2161S	probably damaging	Het

Other mutations in Abca1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00429:Abca1	APN	4	53059255	critical splice donor site	probably null
IGL00778:Abca1	APN	4	53086132	missense	probably benign
IGL01013:Abca1	APN	4	53038185	nonsense	probably null
IGL01510:Abca1	APN	4	53143979	missense	probably damaging	0.97
IGL01608:Abca1	APN	4	53038158	missense	probably damaging	1.00
IGL01845:Abca1	APN	4	53090297	missense	probably damaging	1.00
IGL02048:Abca1	APN	4	53069831	missense	probably damaging	1.00
IGL02249:Abca1	APN	4	53068739	nonsense	probably null
IGL02569:Abca1	APN	4	53034061	missense	probably damaging	1.00
IGL02622:Abca1	APN	4	53034046	missense	probably damaging	0.99
R6720_abca1_529	UTSW	4	53083733	missense	probably damaging	1.00
R0042:Abca1	UTSW	4	53059245	splice site	probably benign
R0042:Abca1	UTSW	4	53059245	splice site	probably benign
R0050:Abca1	UTSW	4	53069910	splice site	probably benign
R0107:Abca1	UTSW	4	53080834	missense	probably benign	0.00
R0127:Abca1	UTSW	4	53067155	missense	probably benign	0.00
R0178:Abca1	UTSW	4	53081953	missense	possibly damaging	0.89
R0207:Abca1	UTSW	4	53086039	missense	probably damaging	0.97
R0267:Abca1	UTSW	4	53046105	missense	probably damaging	1.00
R0269:Abca1	UTSW	4	53044228	missense	probably benign
R0586:Abca1	UTSW	4	53092860	missense	probably benign	0.00
R0587:Abca1	UTSW	4	53107035	missense	probably benign	0.00
R1403:Abca1	UTSW	4	53059253	splice site	probably benign
R1404:Abca1	UTSW	4	53059253	splice site	probably benign
R1405:Abca1	UTSW	4	53059253	splice site	probably benign
R1558:Abca1	UTSW	4	53092887	missense	probably null	0.00
R1655:Abca1	UTSW	4	53050964	missense	probably benign
R1662:Abca1	UTSW	4	53090251	splice site	probably null
R1769:Abca1	UTSW	4	53074325	missense	probably damaging	1.00
R1898:Abca1	UTSW	4	53071977	missense	probably benign	0.08
R1945:Abca1	UTSW	4	53061509	frame shift	probably null
R1966:Abca1	UTSW	4	53050409	missense	probably damaging	1.00
R2055:Abca1	UTSW	4	53069881	missense	probably benign
R2185:Abca1	UTSW	4	53089830	missense	probably benign	0.12
R2202:Abca1	UTSW	4	53090291	missense	probably damaging	0.96
R2203:Abca1	UTSW	4	53090291	missense	probably damaging	0.96
R2204:Abca1	UTSW	4	53090291	missense	probably damaging	0.96
R3056:Abca1	UTSW	4	53127626	missense	probably benign
R3849:Abca1	UTSW	4	53061481	splice site	probably benign
R3850:Abca1	UTSW	4	53061481	splice site	probably benign
R3906:Abca1	UTSW	4	53067151	missense	possibly damaging	0.84
R3908:Abca1	UTSW	4	53067151	missense	possibly damaging	0.84
R4050:Abca1	UTSW	4	53044144	missense	probably damaging	1.00
R4204:Abca1	UTSW	4	53090369	missense	probably benign	0.00
R4225:Abca1	UTSW	4	53085106	missense	possibly damaging	0.87
R4979:Abca1	UTSW	4	53085092	splice site	probably null
R5022:Abca1	UTSW	4	53041570	frame shift	probably null
R5168:Abca1	UTSW	4	53086070	missense	probably benign
R5363:Abca1	UTSW	4	53132963	missense	probably benign	0.00
R5439:Abca1	UTSW	4	53042381	missense	possibly damaging	0.55
R5604:Abca1	UTSW	4	53067168	splice site	probably null
R5614:Abca1	UTSW	4	53046132	missense	probably damaging	1.00
R5810:Abca1	UTSW	4	53079631	missense	probably benign
R6001:Abca1	UTSW	4	53075555	missense	possibly damaging	0.68
R6151:Abca1	UTSW	4	53085261	missense	probably benign
R6185:Abca1	UTSW	4	53078089	missense	probably benign	0.31
R6262:Abca1	UTSW	4	53092917	missense	probably benign	0.01
R6455:Abca1	UTSW	4	53042376	missense	probably damaging	0.98
R6472:Abca1	UTSW	4	53085991	critical splice donor site	probably null
R6564:Abca1	UTSW	4	53034031	missense	possibly damaging	0.85
R6720:Abca1	UTSW	4	53083733	missense	probably damaging	1.00
R6903:Abca1	UTSW	4	53143952	missense	probably benign	0.17
R6960:Abca1	UTSW	4	53072924	missense	probably benign	0.00
R7065:Abca1	UTSW	4	53074233	missense	probably damaging	0.98
R7142:Abca1	UTSW	4	53082050	missense	probably damaging	1.00
R7322:Abca1	UTSW	4	53067151	missense	probably damaging	0.97
R7520:Abca1	UTSW	4	53078114	missense	probably benign
R7547:Abca1	UTSW	4	53109269	missense	probably benign	0.02
R7793:Abca1	UTSW	4	53042367	missense	not run
R7863:Abca1	UTSW	4	53107179	missense	probably benign
R7877:Abca1	UTSW	4	53046135	missense	possibly damaging	0.55
R8010:Abca1	UTSW	4	53127600	missense	probably benign
R8058:Abca1	UTSW	4	53081954	missense	possibly damaging	0.60
R8181:Abca1	UTSW	4	53059303	missense	probably benign	0.21
R8471:Abca1	UTSW	4	53044187	missense	probably damaging	1.00
R8774:Abca1	UTSW	4	53090358	missense	possibly damaging	0.89
R8774-TAIL:Abca1	UTSW	4	53090358	missense	possibly damaging	0.89
R8806:Abca1	UTSW	4	53084520	missense	probably benign	0.17
R8841:Abca1	UTSW	4	53143925	splice site	probably benign
R9081:Abca1	UTSW	4	53109162	critical splice donor site	probably null
R9483:Abca1	UTSW	4	53060351	missense	probably benign	0.11
R9532:Abca1	UTSW	4	53109284	missense	probably benign
R9621:Abca1	UTSW	4	53092918	missense	probably benign	0.00
R9638:Abca1	UTSW	4	53092806	missense	probably damaging	0.96
RF005:Abca1	UTSW	4	53049125	missense	probably damaging	0.97
RF024:Abca1	UTSW	4	53049125	missense	probably damaging	0.97
X0023:Abca1	UTSW	4	53049038	missense	possibly damaging	0.91
Z1177:Abca1	UTSW	4	53079584	missense	probably benign	0.00
Z1177:Abca1	UTSW	4	53080799	missense	probably benign	0.01
Z1177:Abca1	UTSW	4	53086133	missense	possibly damaging	0.73

Predicted Primers

PCR Primer
(F):5'- AGCCAACTTCTCAGTCATGC -3'
(R):5'- TGATTCCCAGCTTCCACAGG -3'

Sequencing Primer
(F):5'- TCATGCCGACAGGGACTCAC -3'
(R):5'- CAGGCTTCTGTGAGAGCAAAC -3'

Posted On

2015-09-24