Incidental Mutation 'R0346:Plekhg5'
ID34254
Institutional Source Beutler Lab
Gene Symbol Plekhg5
Ensembl Gene ENSMUSG00000039713
Gene Namepleckstrin homology domain containing, family G (with RhoGef domain) member 5
Synonyms
MMRRC Submission 038553-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.187) question?
Stock #R0346 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location152072498-152115400 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 152114253 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 966 (L966P)
Ref Sequence ENSEMBL: ENSMUSP00000101286 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025706] [ENSMUST00000035275] [ENSMUST00000084115] [ENSMUST00000105661] [ENSMUST00000105662] [ENSMUST00000118648]
Predicted Effect probably benign
Transcript: ENSMUST00000025706
SMART Domains Protein: ENSMUSP00000025706
Gene: ENSMUSG00000024793

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
TNFR 38 75 4.12e0 SMART
TNFR 78 120 3.78e-5 SMART
transmembrane domain 196 218 N/A INTRINSIC
DEATH 315 407 6.04e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000035275
SMART Domains Protein: ENSMUSP00000047823
Gene: ENSMUSG00000024793

DomainStartEndE-ValueType
signal peptide 1 43 N/A INTRINSIC
TNFR 51 88 4.12e0 SMART
TNFR 91 133 3.78e-5 SMART
transmembrane domain 172 194 N/A INTRINSIC
DEATH 291 383 6.04e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000084115
AA Change: L966P

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000081132
Gene: ENSMUSG00000039713
AA Change: L966P

DomainStartEndE-ValueType
low complexity region 314 334 N/A INTRINSIC
low complexity region 369 380 N/A INTRINSIC
RhoGEF 410 597 5.21e-53 SMART
PH 655 756 7.35e-12 SMART
low complexity region 778 790 N/A INTRINSIC
low complexity region 895 934 N/A INTRINSIC
low complexity region 1060 1069 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105661
AA Change: L966P

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000101286
Gene: ENSMUSG00000039713
AA Change: L966P

DomainStartEndE-ValueType
low complexity region 314 334 N/A INTRINSIC
low complexity region 369 380 N/A INTRINSIC
RhoGEF 410 597 5.21e-53 SMART
PH 655 756 7.35e-12 SMART
low complexity region 778 790 N/A INTRINSIC
low complexity region 895 934 N/A INTRINSIC
low complexity region 1060 1069 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105662
AA Change: L934P

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000101287
Gene: ENSMUSG00000039713
AA Change: L934P

DomainStartEndE-ValueType
low complexity region 282 302 N/A INTRINSIC
low complexity region 337 348 N/A INTRINSIC
RhoGEF 378 565 5.21e-53 SMART
PH 623 724 7.35e-12 SMART
low complexity region 746 758 N/A INTRINSIC
low complexity region 863 902 N/A INTRINSIC
low complexity region 1028 1037 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118648
AA Change: L953P

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000112707
Gene: ENSMUSG00000039713
AA Change: L953P

DomainStartEndE-ValueType
low complexity region 301 321 N/A INTRINSIC
low complexity region 356 367 N/A INTRINSIC
RhoGEF 397 584 5.21e-53 SMART
PH 642 743 7.35e-12 SMART
low complexity region 765 777 N/A INTRINSIC
low complexity region 882 921 N/A INTRINSIC
low complexity region 1047 1056 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127111
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140085
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153619
Meta Mutation Damage Score 0.0979 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.4%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: This gene encodes a protein belonging to the Rho guanine exchange factor (GEF) family of proteins, which activate GTPases by replacing GDP with GTP. This family member is a RhoA GEF that plays a role in endothelial cell migration and tube formation. It is required for angiogenesis and may function in neuronal cell differentiation. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Oct 2013]
PHENOTYPE: Mice homozygous for a knock-out allele display angiogenic defects that affect multiple organs, including sparser coronary and kidney arterial systems that appear to deficient in small diameter vessels while the major coronary and kidney arteries remain intact. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,566,278 I4406L probably damaging Het
Abca16 T A 7: 120,435,932 C314S probably damaging Het
Add3 C T 19: 53,216,956 R46* probably null Het
Alas1 A T 9: 106,243,351 S82T possibly damaging Het
Alkbh5 C G 11: 60,538,741 R107G possibly damaging Het
Ap3b1 A T 13: 94,445,971 R365* probably null Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
AU021092 T C 16: 5,216,854 D168G possibly damaging Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Caln1 C A 5: 130,822,921 H184N possibly damaging Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Ccdc191 T C 16: 43,938,952 V372A probably damaging Het
Ccng2 T G 5: 93,270,894 I126S probably damaging Het
Cep85 A T 4: 134,132,422 N643K probably damaging Het
Clvs2 G C 10: 33,622,546 S129R possibly damaging Het
Cntn1 G T 15: 92,232,087 probably benign Het
Cttn A T 7: 144,452,539 probably benign Het
Dedd2 T C 7: 25,211,269 S161G possibly damaging Het
Dnajb13 T C 7: 100,503,925 D263G probably damaging Het
Dppa4 T A 16: 48,289,324 probably benign Het
Ear2 A G 14: 44,102,906 E7G probably damaging Het
Eif2b4 A G 5: 31,188,108 probably benign Het
Etl4 G T 2: 20,759,652 probably null Het
Fbxo15 T A 18: 84,960,221 probably null Het
Gm8765 T C 13: 50,703,310 Y995H probably benign Het
Gm9970 A G 5: 31,240,838 probably benign Het
Hap1 A G 11: 100,356,029 S17P probably benign Het
Hgd C T 16: 37,588,774 probably benign Het
Inpp5f T A 7: 128,690,668 L16Q probably damaging Het
Islr2 G A 9: 58,198,343 R545* probably null Het
Itgav G T 2: 83,792,609 C675F probably damaging Het
Kif13a T A 13: 46,814,219 I403L possibly damaging Het
Kif14 T A 1: 136,468,160 I68N probably damaging Het
Kif26a G T 12: 112,179,348 K1764N probably null Het
Lrrd1 C A 5: 3,850,215 F173L probably benign Het
Mroh4 G C 15: 74,614,292 probably benign Het
Mrvi1 T C 7: 110,898,976 D404G probably damaging Het
Msh5 A G 17: 35,029,888 V723A probably benign Het
Mybph T G 1: 134,197,754 I279S probably damaging Het
Myh4 A T 11: 67,260,326 I1936L probably benign Het
Myo1h A T 5: 114,355,209 T704S probably benign Het
Nav2 C A 7: 49,604,585 T2377K probably benign Het
Nipbl T G 15: 8,360,956 Q276H probably damaging Het
Nlrp9b T C 7: 20,024,515 L559P probably damaging Het
Nup210l T A 3: 90,189,438 V1318E probably damaging Het
Olfr1427 A T 19: 12,099,439 S67T probably damaging Het
Olfr18 A G 9: 20,314,411 S170P probably benign Het
Olfr385 A G 11: 73,589,457 Y94H probably damaging Het
Olfr765 C A 10: 129,046,473 V197F possibly damaging Het
P2ry13 T C 3: 59,209,566 T264A possibly damaging Het
Prss35 A G 9: 86,755,351 K58R probably benign Het
Ptafr T A 4: 132,580,079 L260* probably null Het
Pum1 A T 4: 130,779,805 T1157S possibly damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rnf145 A G 11: 44,555,164 Y275C probably damaging Het
Rpl6 A T 5: 121,208,491 K218N possibly damaging Het
Rps6 T C 4: 86,855,981 T128A probably benign Het
Ryr1 G T 7: 29,067,588 probably benign Het
Scel A T 14: 103,529,984 Q26H probably damaging Het
Sfxn4 A T 19: 60,858,673 D57E probably benign Het
Slc35d1 A C 4: 103,190,847 L240R probably damaging Het
Smcr8 A G 11: 60,779,750 I575V probably benign Het
Syk G A 13: 52,640,659 M476I probably damaging Het
Tbcel A T 9: 42,437,243 probably benign Het
Tob2 C A 15: 81,858,223 G65W probably damaging Het
Trim16 A G 11: 62,840,694 N464D probably benign Het
Trim36 T C 18: 46,199,709 probably benign Het
Trpv4 C A 5: 114,630,529 probably benign Het
Tsga10 T A 1: 37,840,519 T64S possibly damaging Het
Ttc26 T C 6: 38,409,435 C364R probably damaging Het
Vars2 A T 17: 35,664,864 probably benign Het
Vmn1r72 C A 7: 11,669,694 V276L probably benign Het
Vps13a T A 19: 16,677,969 K1898N probably benign Het
Vps18 A G 2: 119,297,164 M823V probably damaging Het
Washc2 T C 6: 116,220,523 probably benign Het
Zfp763 A T 17: 33,019,747 H141Q probably benign Het
Other mutations in Plekhg5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Plekhg5 APN 4 152102041 splice site probably null
IGL01025:Plekhg5 APN 4 152108526 missense probably damaging 1.00
IGL01062:Plekhg5 APN 4 152108496 missense probably damaging 1.00
IGL01138:Plekhg5 APN 4 152106978 missense probably damaging 1.00
IGL01301:Plekhg5 APN 4 152112553 missense probably benign
IGL02372:Plekhg5 APN 4 152102080 missense probably damaging 0.96
IGL02701:Plekhg5 APN 4 152103022 missense probably damaging 1.00
ANU18:Plekhg5 UTSW 4 152112553 missense probably benign
R0005:Plekhg5 UTSW 4 152112651 small deletion probably benign
R0012:Plekhg5 UTSW 4 152104750 missense probably benign 0.20
R0050:Plekhg5 UTSW 4 152108088 critical splice donor site probably null
R0233:Plekhg5 UTSW 4 152112219 missense probably damaging 1.00
R0233:Plekhg5 UTSW 4 152112219 missense probably damaging 1.00
R0234:Plekhg5 UTSW 4 152112219 missense probably damaging 1.00
R0555:Plekhg5 UTSW 4 152107469 nonsense probably null
R0631:Plekhg5 UTSW 4 152112419 missense possibly damaging 0.89
R0639:Plekhg5 UTSW 4 152114120 missense probably benign 0.19
R1372:Plekhg5 UTSW 4 152104731 missense probably damaging 0.99
R1563:Plekhg5 UTSW 4 152096809 missense probably benign 0.33
R2870:Plekhg5 UTSW 4 152107503 missense probably benign 0.01
R2870:Plekhg5 UTSW 4 152107503 missense probably benign 0.01
R2871:Plekhg5 UTSW 4 152107503 missense probably benign 0.01
R2871:Plekhg5 UTSW 4 152107503 missense probably benign 0.01
R2872:Plekhg5 UTSW 4 152107503 missense probably benign 0.01
R2872:Plekhg5 UTSW 4 152107503 missense probably benign 0.01
R2873:Plekhg5 UTSW 4 152107503 missense probably benign 0.01
R3104:Plekhg5 UTSW 4 152112178 missense probably damaging 1.00
R3106:Plekhg5 UTSW 4 152112178 missense probably damaging 1.00
R3408:Plekhg5 UTSW 4 152108292 missense probably damaging 1.00
R4289:Plekhg5 UTSW 4 152112427 missense probably benign 0.05
R5157:Plekhg5 UTSW 4 152107865 splice site probably benign
R5643:Plekhg5 UTSW 4 152104340 missense probably benign 0.14
R5644:Plekhg5 UTSW 4 152104340 missense probably benign 0.14
R5790:Plekhg5 UTSW 4 152113935 missense probably benign
R6770:Plekhg5 UTSW 4 152103079 missense probably benign
R7027:Plekhg5 UTSW 4 152113974 missense probably benign 0.01
R7039:Plekhg5 UTSW 4 152107785 missense possibly damaging 0.90
R7092:Plekhg5 UTSW 4 152114508 missense probably damaging 1.00
R7309:Plekhg5 UTSW 4 152112528 missense possibly damaging 0.50
R7319:Plekhg5 UTSW 4 152108428 missense probably benign 0.13
R7439:Plekhg5 UTSW 4 152113935 missense probably benign 0.19
R7543:Plekhg5 UTSW 4 152108034 missense probably damaging 1.00
R7662:Plekhg5 UTSW 4 152104298 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGACTTTGTGGCTCCACACCC -3'
(R):5'- TCCCAGAAGGCATCTCTCTGCATC -3'

Sequencing Primer
(F):5'- CGCCTGTGCCTCAGACC -3'
(R):5'- CATCTCCTTCGGGCAGAATC -3'
Posted On2013-05-09