Mutagenetix > Incidental Mutation

Incidental Mutation 'R4577:Acacb'

342541

Institutional Source

Beutler Lab

Gene Symbol

Acacb

Ensembl Gene

ENSMUSG00000042010

Gene Name

acetyl-Coenzyme A carboxylase beta

Synonyms

Acc2, Accb

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4577 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

114146535-114250761 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 114226831 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 1524 (E1524G)

Ref Sequence

ENSEMBL: ENSMUSP00000099642 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031583] [ENSMUST00000102582]

AlphaFold

E9Q4Z2

Predicted Effect

probably damaging
Transcript: ENSMUST00000031583
AA Change: E1524G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000031583
Gene: ENSMUSG00000042010
AA Change: E1524G

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
low complexity region	38	60	N/A	INTRINSIC
Pfam:CPSase_L_chain	249	369	2.1e-32	PFAM
Pfam:CPSase_L_D2	405	606	3.3e-52	PFAM
Pfam:ATP-grasp_4	413	576	2.1e-9	PFAM
Biotin_carb_C	640	747	9.54e-26	SMART
Pfam:Biotin_lipoyl	885	951	1.9e-17	PFAM
Pfam:ACC_central	952	1678	2.2e-290	PFAM
Pfam:Carboxyl_trans	1770	2324	2.3e-181	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000102582
AA Change: E1524G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000099642
Gene: ENSMUSG00000042010
AA Change: E1524G

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
low complexity region	38	60	N/A	INTRINSIC
Pfam:CPSase_L_chain	249	369	8.2e-29	PFAM
Pfam:CPSase_L_D2	405	606	3.8e-52	PFAM
Pfam:ATP-grasp_4	409	576	1.4e-12	PFAM
Biotin_carb_C	640	747	9.54e-26	SMART
Pfam:Biotin_lipoyl	885	951	9.1e-17	PFAM
Pfam:ACC_central	952	1678	2.3e-250	PFAM
Pfam:Carboxyl_trans	1770	2324	4.8e-172	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143276

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acetyl-CoA carboxylase (ACC) is a complex multifunctional enzyme system. ACC is a biotin-containing enzyme which catalyzes the carboxylation of acetyl-CoA to malonyl-CoA, the rate-limiting step in fatty acid synthesis. ACC-beta is thought to control fatty acid oxidation by means of the ability of malonyl-CoA to inhibit carnitine-palmitoyl-CoA transferase I, the rate-limiting step in fatty acid uptake and oxidation by mitochondria. ACC-beta may be involved in the regulation of fatty acid oxidation, rather than fatty acid biosynthesis. There is evidence for the presence of two ACC-beta isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable, fertile and overtly normal but exhibit high levels of fatty acid oxidation, as well as reduced fat accumulation in their adipose tissue and liver, and decreased storage of glycogen in their liver. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6430531B16Rik	A	G	7: 139,978,130	I51T	probably damaging	Het
Abca1	C	A	4: 53,062,568	C1429F	possibly damaging	Het
Ankrd50	A	G	3: 38,455,941	V759A	probably damaging	Het
Ano9	T	C	7: 141,104,138	Q538R	probably damaging	Het
Bnip2	A	G	9: 69,997,162	D67G	probably benign	Het
Cacna1e	A	T	1: 154,402,027	S2060T	possibly damaging	Het
Cand2	G	A	6: 115,791,259	C455Y	probably damaging	Het
Cdh16	T	C	8: 104,618,559	D366G	probably damaging	Het
Cep170b	A	G	12: 112,744,718	R595G	probably damaging	Het
Chaf1a	G	A	17: 56,065,184	R784Q	probably damaging	Het
Clca4a	C	A	3: 144,954,969	S698I	probably damaging	Het
Dnah5	A	C	15: 28,289,250	Y1195S	probably benign	Het
Dysf	T	C	6: 84,137,326	I1229T	probably damaging	Het
Eef2	GCCC	GCCCC	10: 81,178,767		probably null	Het
Ep300	T	A	15: 81,611,410		probably benign	Het
Ep300	T	C	15: 81,649,009	S1756P	unknown	Het
F3	A	G	3: 121,734,114	I254V	probably benign	Het
Fam166a	T	C	2: 25,220,288	S71P	probably benign	Het
Frmd4a	C	A	2: 4,603,679	A786E	possibly damaging	Het
Fsd1l	T	C	4: 53,686,397	F270S	probably damaging	Het
Galnt3	T	C	2: 66,097,859	Y231C	probably benign	Het
Gm10220	A	C	5: 26,117,871	I181S	probably benign	Het
Gm13178	A	C	4: 144,703,753	I222S	probably damaging	Het
Gnb5	G	A	9: 75,343,541	V316I	possibly damaging	Het
Gys2	A	G	6: 142,454,510	F325S	possibly damaging	Het
Hmgn2	G	A	4: 133,967,357		probably benign	Het
Hsph1	A	G	5: 149,618,843	V705A	probably benign	Het
Ighg2b	T	C	12: 113,306,892	E206G	unknown	Het
Iqub	A	T	6: 24,501,291	I220N	probably damaging	Het
Jmjd1c	A	G	10: 67,249,750	T2259A	probably damaging	Het
Kcnq3	T	C	15: 66,286,214	K4R	unknown	Het
Klk12	A	G	7: 43,773,243	D198G	probably damaging	Het
L3mbtl2	G	A	15: 81,686,285	E655K	probably benign	Het
Lrp1b	C	T	2: 40,821,719	C3163Y	probably damaging	Het
Map3k19	T	A	1: 127,822,813	R934*	probably null	Het
Map4	A	G	9: 110,081,421	T1061A	possibly damaging	Het
Mbnl1	G	A	3: 60,529,778	V50I	probably damaging	Het
Med15	G	A	16: 17,674,515	Q132*	probably null	Het
Mef2a	T	C	7: 67,240,439	N131S	probably benign	Het
Mtmr3	G	C	11: 4,497,375	L361V	probably damaging	Het
Myo5a	A	G	9: 75,217,545	E1792G	probably damaging	Het
Nup88	C	A	11: 70,969,717	A55S	probably damaging	Het
Olfr1252	T	C	2: 89,722,043	K23E	possibly damaging	Het
Olfr374	T	A	8: 72,110,323	Y252*	probably null	Het
Pacs1	G	T	19: 5,143,833	S556*	probably null	Het
Parp4	A	G	14: 56,590,410	E206G	probably benign	Het
Paxbp1	T	G	16: 91,015,154	K889N	probably damaging	Het
Pcdhga2	G	A	18: 37,669,249	A49T	possibly damaging	Het
Pcsk6	T	A	7: 65,959,266	L292*	probably null	Het
Plb1	C	T	5: 32,247,557	Q20*	probably null	Het
Plec	C	A	15: 76,184,069	Q1142H	possibly damaging	Het
Pnpla2	T	C	7: 141,457,344	S87P	probably damaging	Het
Prss28	T	C	17: 25,310,105	V140A	probably damaging	Het
Rad17	A	T	13: 100,633,278	S258T	probably damaging	Het
Rnf111	A	T	9: 70,429,584	C932*	probably null	Het
Sdc2	T	C	15: 33,017,132	Y31H	probably damaging	Het
Selenoh	T	C	2: 84,670,331	E55G	possibly damaging	Het
Serpina3k	T	G	12: 104,344,192	V327G	possibly damaging	Het
Setd1b	A	G	5: 123,148,616	E575G	unknown	Het
Slco1a4	A	T	6: 141,819,540	S325R	probably damaging	Het
Smtnl1	C	A	2: 84,818,443	V156L	possibly damaging	Het
Speg	A	G	1: 75,415,395	D1607G	probably damaging	Het
Tctex1d4	A	G	4: 117,128,615	T212A	possibly damaging	Het
Tmem101	T	A	11: 102,155,837	M69L	possibly damaging	Het
Treh	G	A	9: 44,685,911	M542I	probably benign	Het
Trim30b	T	C	7: 104,357,331	Y106C	possibly damaging	Het
Ttc6	T	C	12: 57,576,655	I280T	probably benign	Het
Ubtfl1	A	G	9: 18,409,493	T106A	probably damaging	Het
Wdr27	T	C	17: 14,903,462	H583R	probably benign	Het
Xirp2	C	T	2: 67,513,897	P2161S	probably damaging	Het

Other mutations in Acacb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00482:Acacb	APN	5	114200289	missense	probably damaging	1.00
IGL01291:Acacb	APN	5	114225870	missense	probably benign	0.03
IGL01301:Acacb	APN	5	114246498	missense	probably benign
IGL01633:Acacb	APN	5	114218858	splice site	probably benign
IGL01736:Acacb	APN	5	114188442	missense	possibly damaging	0.96
IGL01782:Acacb	APN	5	114200520	missense	probably damaging	1.00
IGL01924:Acacb	APN	5	114223986	splice site	probably benign
IGL01933:Acacb	APN	5	114184190	splice site	probably benign
IGL02028:Acacb	APN	5	114166015	missense	probably damaging	1.00
IGL02045:Acacb	APN	5	114240660	missense	possibly damaging	0.95
IGL02346:Acacb	APN	5	114238699	missense	probably damaging	1.00
IGL02421:Acacb	APN	5	114223878	missense	probably benign	0.00
IGL02445:Acacb	APN	5	114245137	missense	probably damaging	1.00
IGL02491:Acacb	APN	5	114192105	missense	probably damaging	1.00
IGL02598:Acacb	APN	5	114246037	missense	probably damaging	1.00
IGL02700:Acacb	APN	5	114218881	missense	probably damaging	1.00
IGL02730:Acacb	APN	5	114166149	splice site	probably benign
IGL03110:Acacb	APN	5	114195234	missense	probably damaging	0.96
IGL03125:Acacb	APN	5	114204805	missense	possibly damaging	0.49
IGL03263:Acacb	APN	5	114213693	missense	probably damaging	1.00
IGL03324:Acacb	APN	5	114225854	nonsense	probably null
acetone	UTSW	5	114226857	nonsense	probably null
anabolism	UTSW	5	114245220	missense	possibly damaging	0.63
ANU05:Acacb	UTSW	5	114225870	missense	probably benign	0.03
ANU18:Acacb	UTSW	5	114246498	missense	probably benign
BB001:Acacb	UTSW	5	114245220	missense	possibly damaging	0.63
BB011:Acacb	UTSW	5	114245220	missense	possibly damaging	0.63
I0000:Acacb	UTSW	5	114238655	missense	probably damaging	0.99
R0001:Acacb	UTSW	5	114204833	splice site	probably benign
R0219:Acacb	UTSW	5	114232944	missense	possibly damaging	0.79
R0234:Acacb	UTSW	5	114209817	missense	probably damaging	0.99
R0234:Acacb	UTSW	5	114209817	missense	probably damaging	0.99
R0278:Acacb	UTSW	5	114233259	nonsense	probably null
R0607:Acacb	UTSW	5	114200301	missense	probably damaging	1.00
R0964:Acacb	UTSW	5	114229752	missense	possibly damaging	0.64
R1116:Acacb	UTSW	5	114210956	missense	probably damaging	1.00
R1196:Acacb	UTSW	5	114245092	missense	probably benign	0.00
R1204:Acacb	UTSW	5	114190153	missense	probably damaging	1.00
R1387:Acacb	UTSW	5	114200512	missense	probably benign
R1415:Acacb	UTSW	5	114165921	missense	probably benign
R1475:Acacb	UTSW	5	114195252	missense	possibly damaging	0.87
R1497:Acacb	UTSW	5	114196807	missense	probably damaging	1.00
R1520:Acacb	UTSW	5	114201940	missense	possibly damaging	0.67
R1591:Acacb	UTSW	5	114203423	missense	possibly damaging	0.87
R1644:Acacb	UTSW	5	114195285	missense	probably damaging	1.00
R1732:Acacb	UTSW	5	114190087	missense	possibly damaging	0.63
R1783:Acacb	UTSW	5	114209767	frame shift	probably null
R1784:Acacb	UTSW	5	114209767	frame shift	probably null
R1834:Acacb	UTSW	5	114235475	missense	probably damaging	1.00
R1858:Acacb	UTSW	5	114196709	missense	probably benign	0.13
R1886:Acacb	UTSW	5	114218959	missense	probably damaging	1.00
R1901:Acacb	UTSW	5	114165734	nonsense	probably null
R1902:Acacb	UTSW	5	114165734	nonsense	probably null
R1903:Acacb	UTSW	5	114165734	nonsense	probably null
R1924:Acacb	UTSW	5	114230720	missense	possibly damaging	0.67
R1934:Acacb	UTSW	5	114198282	missense	probably benign	0.27
R2051:Acacb	UTSW	5	114245890	missense	probably damaging	1.00
R2132:Acacb	UTSW	5	114209767	frame shift	probably null
R2133:Acacb	UTSW	5	114209767	frame shift	probably null
R2260:Acacb	UTSW	5	114216917	missense	probably damaging	0.99
R2967:Acacb	UTSW	5	114166070	missense	possibly damaging	0.81
R3421:Acacb	UTSW	5	114212636	splice site	probably null
R3729:Acacb	UTSW	5	114207348	missense	probably damaging	0.99
R4206:Acacb	UTSW	5	114213651	missense	probably benign
R4245:Acacb	UTSW	5	114230784	missense	probably damaging	0.97
R4386:Acacb	UTSW	5	114241921	critical splice acceptor site	probably null
R4439:Acacb	UTSW	5	114246496	missense	possibly damaging	0.50
R4658:Acacb	UTSW	5	114200564	missense	probably damaging	0.96
R4688:Acacb	UTSW	5	114204763	missense	probably benign	0.01
R4720:Acacb	UTSW	5	114229914	missense	possibly damaging	0.73
R4898:Acacb	UTSW	5	114232938	missense	probably benign	0.04
R5044:Acacb	UTSW	5	114166027	missense	probably benign	0.03
R5070:Acacb	UTSW	5	114246028	missense	possibly damaging	0.46
R5294:Acacb	UTSW	5	114241952	missense	probably damaging	1.00
R5350:Acacb	UTSW	5	114244551	missense	probably damaging	1.00
R5401:Acacb	UTSW	5	114209853	missense	possibly damaging	0.80
R5531:Acacb	UTSW	5	114204706	missense	possibly damaging	0.92
R5542:Acacb	UTSW	5	114195737	missense	probably damaging	1.00
R5751:Acacb	UTSW	5	114230832	missense	possibly damaging	0.79
R5821:Acacb	UTSW	5	114184106	missense	possibly damaging	0.69
R5893:Acacb	UTSW	5	114229851	missense	probably benign	0.01
R5911:Acacb	UTSW	5	114232890	missense	probably damaging	0.97
R5944:Acacb	UTSW	5	114245980	missense	probably damaging	1.00
R5973:Acacb	UTSW	5	114226867	missense	probably damaging	1.00
R6027:Acacb	UTSW	5	114165600	missense	probably benign	0.43
R6103:Acacb	UTSW	5	114245881	missense	probably damaging	1.00
R6139:Acacb	UTSW	5	114212652	missense	probably damaging	1.00
R6292:Acacb	UTSW	5	114200251	missense	probably damaging	1.00
R6368:Acacb	UTSW	5	114216823	missense	probably damaging	0.98
R6429:Acacb	UTSW	5	114228591	missense	probably damaging	1.00
R6942:Acacb	UTSW	5	114191963	critical splice donor site	probably null
R7138:Acacb	UTSW	5	114207326	missense	probably benign	0.12
R7241:Acacb	UTSW	5	114245100	missense	possibly damaging	0.94
R7254:Acacb	UTSW	5	114209751	critical splice acceptor site	probably null
R7396:Acacb	UTSW	5	114213661	missense	possibly damaging	0.87
R7439:Acacb	UTSW	5	114195642	missense	possibly damaging	0.84
R7484:Acacb	UTSW	5	114218862	missense	probably damaging	1.00
R7585:Acacb	UTSW	5	114246012	missense	probably damaging	0.99
R7712:Acacb	UTSW	5	114165738	missense	probably benign	0.13
R7868:Acacb	UTSW	5	114248227	missense	probably benign	0.22
R7873:Acacb	UTSW	5	114223278	missense	possibly damaging	0.88
R7924:Acacb	UTSW	5	114245220	missense	possibly damaging	0.63
R7940:Acacb	UTSW	5	114166047	missense	possibly damaging	0.77
R7951:Acacb	UTSW	5	114188340	missense	probably damaging	1.00
R7960:Acacb	UTSW	5	114230861	missense	probably benign	0.00
R7972:Acacb	UTSW	5	114226857	nonsense	probably null
R8007:Acacb	UTSW	5	114218874	missense	probably damaging	0.97
R8022:Acacb	UTSW	5	114223854	missense	probably benign
R8030:Acacb	UTSW	5	114233167	missense	probably damaging	1.00
R8241:Acacb	UTSW	5	114195236	missense	possibly damaging	0.49
R8264:Acacb	UTSW	5	114207366	missense	probably benign	0.00
R8292:Acacb	UTSW	5	114200494	critical splice acceptor site	probably null
R8678:Acacb	UTSW	5	114201971	nonsense	probably null
R8693:Acacb	UTSW	5	114226783	missense	probably damaging	0.99
R8697:Acacb	UTSW	5	114213380	missense	probably damaging	0.96
R8772:Acacb	UTSW	5	114184118	missense	possibly damaging	0.73
R8918:Acacb	UTSW	5	114195254	missense	probably damaging	1.00
R9008:Acacb	UTSW	5	114248754	splice site	silent
R9044:Acacb	UTSW	5	114235517	missense	probably benign	0.00
R9165:Acacb	UTSW	5	114216683	missense	probably benign	0.01
R9231:Acacb	UTSW	5	114211092	missense	probably benign	0.01
R9440:Acacb	UTSW	5	114246024	missense	possibly damaging	0.56
R9444:Acacb	UTSW	5	114245959	missense	probably damaging	0.99
R9562:Acacb	UTSW	5	114233336	missense	probably damaging	0.99
R9794:Acacb	UTSW	5	114249517	missense	probably benign	0.00
V1662:Acacb	UTSW	5	114238708	missense	probably damaging	1.00
Z1176:Acacb	UTSW	5	114248948	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- TGACAAATGGACTGTCCTCTCTC -3'
(R):5'- GAAGTACCGCTAGCTGATGTG -3'

Sequencing Primer
(F):5'- GACTGTCCTCTCTCTGGCTGG -3'
(R):5'- TCTGCAAGGAGTCAGGATACCTC -3'

Posted On

2015-09-24