Incidental Mutation 'R4577:Slco1a4'
List |< first << previous [record 61 of 71] next >> last >|
ID342548
Institutional Source Beutler Lab
Gene Symbol Slco1a4
Ensembl Gene ENSMUSG00000030237
Gene Namesolute carrier organic anion transporter family, member 1a4
SynonymsOatp2, Oatp1a4, Slc21a5
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R4577 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location141805440-141856199 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 141819540 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 325 (S325R)
Ref Sequence ENSEMBL: ENSMUSP00000130746 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032364] [ENSMUST00000165990]
Predicted Effect probably damaging
Transcript: ENSMUST00000032364
AA Change: S325R

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000032364
Gene: ENSMUSG00000030237
AA Change: S325R

DomainStartEndE-ValueType
Pfam:OATP 19 598 3.2e-196 PFAM
Pfam:MFS_1 22 421 9.2e-27 PFAM
Pfam:Kazal_2 445 486 5e-10 PFAM
transmembrane domain 600 622 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000165990
AA Change: S325R

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000130746
Gene: ENSMUSG00000030237
AA Change: S325R

DomainStartEndE-ValueType
Pfam:OATP 21 597 3.2e-164 PFAM
Pfam:MFS_1 22 421 7.2e-27 PFAM
Pfam:Kazal_2 445 486 6.8e-11 PFAM
transmembrane domain 600 622 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired organic anion transporter activity and urinary metabolomic profiles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430531B16Rik A G 7: 139,978,130 I51T probably damaging Het
Abca1 C A 4: 53,062,568 C1429F possibly damaging Het
Acacb A G 5: 114,226,831 E1524G probably damaging Het
Ankrd50 A G 3: 38,455,941 V759A probably damaging Het
Ano9 T C 7: 141,104,138 Q538R probably damaging Het
Bnip2 A G 9: 69,997,162 D67G probably benign Het
Cacna1e A T 1: 154,402,027 S2060T possibly damaging Het
Cand2 G A 6: 115,791,259 C455Y probably damaging Het
Cdh16 T C 8: 104,618,559 D366G probably damaging Het
Cep170b A G 12: 112,744,718 R595G probably damaging Het
Chaf1a G A 17: 56,065,184 R784Q probably damaging Het
Clca4a C A 3: 144,954,969 S698I probably damaging Het
Dnah5 A C 15: 28,289,250 Y1195S probably benign Het
Dysf T C 6: 84,137,326 I1229T probably damaging Het
Eef2 GCCC GCCCC 10: 81,178,767 probably null Het
Ep300 T C 15: 81,649,009 S1756P unknown Het
Ep300 T A 15: 81,611,410 probably benign Het
F3 A G 3: 121,734,114 I254V probably benign Het
Fam166a T C 2: 25,220,288 S71P probably benign Het
Frmd4a C A 2: 4,603,679 A786E possibly damaging Het
Fsd1l T C 4: 53,686,397 F270S probably damaging Het
Galnt3 T C 2: 66,097,859 Y231C probably benign Het
Gm10220 A C 5: 26,117,871 I181S probably benign Het
Gm13178 A C 4: 144,703,753 I222S probably damaging Het
Gnb5 G A 9: 75,343,541 V316I possibly damaging Het
Gys2 A G 6: 142,454,510 F325S possibly damaging Het
Hmgn2 G A 4: 133,967,357 probably benign Het
Hsph1 A G 5: 149,618,843 V705A probably benign Het
Ighg2b T C 12: 113,306,892 E206G unknown Het
Iqub A T 6: 24,501,291 I220N probably damaging Het
Jmjd1c A G 10: 67,249,750 T2259A probably damaging Het
Kcnq3 T C 15: 66,286,214 K4R unknown Het
Klk12 A G 7: 43,773,243 D198G probably damaging Het
L3mbtl2 G A 15: 81,686,285 E655K probably benign Het
Lrp1b C T 2: 40,821,719 C3163Y probably damaging Het
Map3k19 T A 1: 127,822,813 R934* probably null Het
Map4 A G 9: 110,081,421 T1061A possibly damaging Het
Mbnl1 G A 3: 60,529,778 V50I probably damaging Het
Med15 G A 16: 17,674,515 Q132* probably null Het
Mef2a T C 7: 67,240,439 N131S probably benign Het
Mtmr3 G C 11: 4,497,375 L361V probably damaging Het
Myo5a A G 9: 75,217,545 E1792G probably damaging Het
Nup88 C A 11: 70,969,717 A55S probably damaging Het
Olfr1252 T C 2: 89,722,043 K23E possibly damaging Het
Olfr374 T A 8: 72,110,323 Y252* probably null Het
Pacs1 G T 19: 5,143,833 S556* probably null Het
Parp4 A G 14: 56,590,410 E206G probably benign Het
Paxbp1 T G 16: 91,015,154 K889N probably damaging Het
Pcdhga2 G A 18: 37,669,249 A49T possibly damaging Het
Pcsk6 T A 7: 65,959,266 L292* probably null Het
Plb1 C T 5: 32,247,557 Q20* probably null Het
Plec C A 15: 76,184,069 Q1142H possibly damaging Het
Pnpla2 T C 7: 141,457,344 S87P probably damaging Het
Prss28 T C 17: 25,310,105 V140A probably damaging Het
Rad17 A T 13: 100,633,278 S258T probably damaging Het
Rnf111 A T 9: 70,429,584 C932* probably null Het
Sdc2 T C 15: 33,017,132 Y31H probably damaging Het
Selenoh T C 2: 84,670,331 E55G possibly damaging Het
Serpina3k T G 12: 104,344,192 V327G possibly damaging Het
Setd1b A G 5: 123,148,616 E575G unknown Het
Smtnl1 C A 2: 84,818,443 V156L possibly damaging Het
Speg A G 1: 75,415,395 D1607G probably damaging Het
Tctex1d4 A G 4: 117,128,615 T212A possibly damaging Het
Tmem101 T A 11: 102,155,837 M69L possibly damaging Het
Treh G A 9: 44,685,911 M542I probably benign Het
Trim30b T C 7: 104,357,331 Y106C possibly damaging Het
Ttc6 T C 12: 57,576,655 I280T probably benign Het
Ubtfl1 A G 9: 18,409,493 T106A probably damaging Het
Wdr27 T C 17: 14,903,462 H583R probably benign Het
Xirp2 C T 2: 67,513,897 P2161S probably damaging Het
Other mutations in Slco1a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00976:Slco1a4 APN 6 141807182 critical splice acceptor site probably null
IGL01573:Slco1a4 APN 6 141812851 splice site probably benign
IGL01735:Slco1a4 APN 6 141817751 missense probably benign 0.00
IGL03115:Slco1a4 APN 6 141819603 missense probably benign 0.05
IGL03115:Slco1a4 APN 6 141817859 missense probably damaging 1.00
R0062:Slco1a4 UTSW 6 141819479 nonsense probably null
R0062:Slco1a4 UTSW 6 141819479 nonsense probably null
R0305:Slco1a4 UTSW 6 141817753 missense possibly damaging 0.47
R0511:Slco1a4 UTSW 6 141830860 splice site probably benign
R0660:Slco1a4 UTSW 6 141812741 missense probably benign 0.05
R0664:Slco1a4 UTSW 6 141812741 missense probably benign 0.05
R1589:Slco1a4 UTSW 6 141845447 missense probably benign
R1606:Slco1a4 UTSW 6 141839611 missense probably damaging 1.00
R1665:Slco1a4 UTSW 6 141839577 missense possibly damaging 0.79
R1742:Slco1a4 UTSW 6 141825045 missense probably benign 0.07
R1763:Slco1a4 UTSW 6 141812731 missense probably benign 0.26
R1893:Slco1a4 UTSW 6 141834616 unclassified probably null
R1908:Slco1a4 UTSW 6 141815447 critical splice donor site probably null
R1944:Slco1a4 UTSW 6 141839550 missense probably benign 0.00
R2144:Slco1a4 UTSW 6 141809378 missense probably damaging 1.00
R2276:Slco1a4 UTSW 6 141815582 missense possibly damaging 0.49
R2340:Slco1a4 UTSW 6 141841377 missense probably benign 0.00
R3017:Slco1a4 UTSW 6 141812670 splice site probably null
R3769:Slco1a4 UTSW 6 141839631 missense probably damaging 1.00
R4650:Slco1a4 UTSW 6 141812698 missense possibly damaging 0.94
R4801:Slco1a4 UTSW 6 141845497 start gained probably benign
R4802:Slco1a4 UTSW 6 141845497 start gained probably benign
R4896:Slco1a4 UTSW 6 141815505 missense possibly damaging 0.91
R5126:Slco1a4 UTSW 6 141815582 missense possibly damaging 0.94
R5183:Slco1a4 UTSW 6 141839631 missense probably damaging 1.00
R5399:Slco1a4 UTSW 6 141830707 missense probably damaging 0.98
R5645:Slco1a4 UTSW 6 141834659 missense possibly damaging 0.95
R5650:Slco1a4 UTSW 6 141809394 missense possibly damaging 0.69
R5832:Slco1a4 UTSW 6 141819544 missense probably benign 0.00
R6180:Slco1a4 UTSW 6 141817820 missense possibly damaging 0.95
R6415:Slco1a4 UTSW 6 141834689 nonsense probably null
R6992:Slco1a4 UTSW 6 141819604 missense probably benign 0.05
R7024:Slco1a4 UTSW 6 141834708 missense probably benign 0.00
R7696:Slco1a4 UTSW 6 141810511 nonsense probably null
R7751:Slco1a4 UTSW 6 141834687 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- TCATGCACTTGAGGATAGATACTG -3'
(R):5'- CAAATGCAGTTTTGTCACAGCAC -3'

Sequencing Primer
(F):5'- GTCATGGAGTCTCTTCACAGCAG -3'
(R):5'- GCAGTTTTGTCACAGCACAGAATC -3'
Posted On2015-09-24