Incidental Mutation 'R4577:Gys2'
ID342549
Institutional Source Beutler Lab
Gene Symbol Gys2
Ensembl Gene ENSMUSG00000030244
Gene Nameglycogen synthase 2
Synonymsglycogen synthase, liver, LGS
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.235) question?
Stock #R4577 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location142422613-142473109 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 142454510 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 325 (F325S)
Ref Sequence ENSEMBL: ENSMUSP00000032371 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032371]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032371
AA Change: F325S

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000032371
Gene: ENSMUSG00000030244
AA Change: F325S

DomainStartEndE-ValueType
Pfam:Glycogen_syn 32 667 N/A PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, liver glycogen synthase, catalyzes the rate-limiting step in the synthesis of glycogen - the transfer of a glucose molecule from UDP-glucose to a terminal branch of the glycogen molecule. Mutations in this gene cause glycogen storage disease type 0 (GSD-0) - a rare type of early childhood fasting hypoglycemia with decreased liver glycogen content. [provided by RefSeq, Dec 2009]
PHENOTYPE: Mice homozygous for a conditional allele knocked out in the liver results in abnormal glycogen homeostasis, altered glucose homeostasis, decreased exercise endurance, and a phenotype similar to patients with glycogen storage disease 0. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430531B16Rik A G 7: 139,978,130 I51T probably damaging Het
Abca1 C A 4: 53,062,568 C1429F possibly damaging Het
Acacb A G 5: 114,226,831 E1524G probably damaging Het
Ankrd50 A G 3: 38,455,941 V759A probably damaging Het
Ano9 T C 7: 141,104,138 Q538R probably damaging Het
Bnip2 A G 9: 69,997,162 D67G probably benign Het
Cacna1e A T 1: 154,402,027 S2060T possibly damaging Het
Cand2 G A 6: 115,791,259 C455Y probably damaging Het
Cdh16 T C 8: 104,618,559 D366G probably damaging Het
Cep170b A G 12: 112,744,718 R595G probably damaging Het
Chaf1a G A 17: 56,065,184 R784Q probably damaging Het
Clca4a C A 3: 144,954,969 S698I probably damaging Het
Dnah5 A C 15: 28,289,250 Y1195S probably benign Het
Dysf T C 6: 84,137,326 I1229T probably damaging Het
Eef2 GCCC GCCCC 10: 81,178,767 probably null Het
Ep300 T C 15: 81,649,009 S1756P unknown Het
Ep300 T A 15: 81,611,410 probably benign Het
F3 A G 3: 121,734,114 I254V probably benign Het
Fam166a T C 2: 25,220,288 S71P probably benign Het
Frmd4a C A 2: 4,603,679 A786E possibly damaging Het
Fsd1l T C 4: 53,686,397 F270S probably damaging Het
Galnt3 T C 2: 66,097,859 Y231C probably benign Het
Gm10220 A C 5: 26,117,871 I181S probably benign Het
Gm13178 A C 4: 144,703,753 I222S probably damaging Het
Gnb5 G A 9: 75,343,541 V316I possibly damaging Het
Hmgn2 G A 4: 133,967,357 probably benign Het
Hsph1 A G 5: 149,618,843 V705A probably benign Het
Ighg2b T C 12: 113,306,892 E206G unknown Het
Iqub A T 6: 24,501,291 I220N probably damaging Het
Jmjd1c A G 10: 67,249,750 T2259A probably damaging Het
Kcnq3 T C 15: 66,286,214 K4R unknown Het
Klk12 A G 7: 43,773,243 D198G probably damaging Het
L3mbtl2 G A 15: 81,686,285 E655K probably benign Het
Lrp1b C T 2: 40,821,719 C3163Y probably damaging Het
Map3k19 T A 1: 127,822,813 R934* probably null Het
Map4 A G 9: 110,081,421 T1061A possibly damaging Het
Mbnl1 G A 3: 60,529,778 V50I probably damaging Het
Med15 G A 16: 17,674,515 Q132* probably null Het
Mef2a T C 7: 67,240,439 N131S probably benign Het
Mtmr3 G C 11: 4,497,375 L361V probably damaging Het
Myo5a A G 9: 75,217,545 E1792G probably damaging Het
Nup88 C A 11: 70,969,717 A55S probably damaging Het
Olfr1252 T C 2: 89,722,043 K23E possibly damaging Het
Olfr374 T A 8: 72,110,323 Y252* probably null Het
Pacs1 G T 19: 5,143,833 S556* probably null Het
Parp4 A G 14: 56,590,410 E206G probably benign Het
Paxbp1 T G 16: 91,015,154 K889N probably damaging Het
Pcdhga2 G A 18: 37,669,249 A49T possibly damaging Het
Pcsk6 T A 7: 65,959,266 L292* probably null Het
Plb1 C T 5: 32,247,557 Q20* probably null Het
Plec C A 15: 76,184,069 Q1142H possibly damaging Het
Pnpla2 T C 7: 141,457,344 S87P probably damaging Het
Prss28 T C 17: 25,310,105 V140A probably damaging Het
Rad17 A T 13: 100,633,278 S258T probably damaging Het
Rnf111 A T 9: 70,429,584 C932* probably null Het
Sdc2 T C 15: 33,017,132 Y31H probably damaging Het
Selenoh T C 2: 84,670,331 E55G possibly damaging Het
Serpina3k T G 12: 104,344,192 V327G possibly damaging Het
Setd1b A G 5: 123,148,616 E575G unknown Het
Slco1a4 A T 6: 141,819,540 S325R probably damaging Het
Smtnl1 C A 2: 84,818,443 V156L possibly damaging Het
Speg A G 1: 75,415,395 D1607G probably damaging Het
Tctex1d4 A G 4: 117,128,615 T212A possibly damaging Het
Tmem101 T A 11: 102,155,837 M69L possibly damaging Het
Treh G A 9: 44,685,911 M542I probably benign Het
Trim30b T C 7: 104,357,331 Y106C possibly damaging Het
Ttc6 T C 12: 57,576,655 I280T probably benign Het
Ubtfl1 A G 9: 18,409,493 T106A probably damaging Het
Wdr27 T C 17: 14,903,462 H583R probably benign Het
Xirp2 C T 2: 67,513,897 P2161S probably damaging Het
Other mutations in Gys2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00466:Gys2 APN 6 142463290 nonsense probably null
IGL02963:Gys2 APN 6 142449428 critical splice donor site probably null
IGL02997:Gys2 APN 6 142449469 missense probably damaging 1.00
candy_corn UTSW 6 142456333 missense probably benign 0.00
embittered UTSW 6 142454484 missense possibly damaging 0.92
hazelnut UTSW 6 142449455 missense possibly damaging 0.67
R0243:Gys2 UTSW 6 142472668 splice site probably benign
R1124:Gys2 UTSW 6 142446013 missense probably damaging 0.97
R1188:Gys2 UTSW 6 142455183 missense probably damaging 1.00
R1208:Gys2 UTSW 6 142450467 critical splice donor site probably null
R1208:Gys2 UTSW 6 142450467 critical splice donor site probably null
R1235:Gys2 UTSW 6 142430293 missense probably damaging 1.00
R1387:Gys2 UTSW 6 142461283 missense probably benign 0.06
R1758:Gys2 UTSW 6 142472706 missense probably damaging 1.00
R1819:Gys2 UTSW 6 142461186 missense probably damaging 1.00
R2221:Gys2 UTSW 6 142456422 missense probably damaging 1.00
R2311:Gys2 UTSW 6 142463244 missense possibly damaging 0.81
R2344:Gys2 UTSW 6 142446022 missense probably damaging 0.99
R3151:Gys2 UTSW 6 142456333 missense probably benign 0.00
R3902:Gys2 UTSW 6 142472800 start codon destroyed probably null 0.98
R4532:Gys2 UTSW 6 142455141 missense probably damaging 0.98
R4588:Gys2 UTSW 6 142449455 missense possibly damaging 0.67
R4606:Gys2 UTSW 6 142454484 missense possibly damaging 0.92
R5338:Gys2 UTSW 6 142454513 missense probably damaging 1.00
R5411:Gys2 UTSW 6 142448421 missense probably damaging 0.99
R6072:Gys2 UTSW 6 142428537 missense probably damaging 0.98
R6261:Gys2 UTSW 6 142459408 missense probably benign
R6366:Gys2 UTSW 6 142463394 missense probably benign 0.02
R6597:Gys2 UTSW 6 142456309 missense probably benign 0.25
R6930:Gys2 UTSW 6 142459380 critical splice donor site probably null
R7033:Gys2 UTSW 6 142472722 missense probably benign 0.08
R7663:Gys2 UTSW 6 142459485 missense probably damaging 1.00
R7757:Gys2 UTSW 6 142454451 missense probably benign 0.10
R7848:Gys2 UTSW 6 142446015 nonsense probably null
R7852:Gys2 UTSW 6 142430333 missense probably damaging 1.00
R7931:Gys2 UTSW 6 142446015 nonsense probably null
R7935:Gys2 UTSW 6 142430333 missense probably damaging 1.00
R8008:Gys2 UTSW 6 142454517 missense probably damaging 1.00
R8037:Gys2 UTSW 6 142448393 missense probably benign 0.44
R8070:Gys2 UTSW 6 142448504 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AATCAAATGCCCTGGAAGCCA -3'
(R):5'- TCCTTTAATCAGAAATAAAAGCACCA -3'

Sequencing Primer
(F):5'- TGGAAGCCAGTTCTTCACG -3'
(R):5'- GATGAACTCTTCTGACCTCCAAGGG -3'
Posted On2015-09-24