Incidental Mutation 'R4577:Pnpla2'
ID342555
Institutional Source Beutler Lab
Gene Symbol Pnpla2
Ensembl Gene ENSMUSG00000025509
Gene Namepatatin-like phospholipase domain containing 2
SynonymsAtgl, 0610039C21Rik, 1110001C14Rik, desnutrin
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.373) question?
Stock #R4577 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location141455198-141460743 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 141457344 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 87 (S87P)
Ref Sequence ENSEMBL: ENSMUSP00000127983 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026583] [ENSMUST00000053670] [ENSMUST00000064151] [ENSMUST00000164016] [ENSMUST00000164924] [ENSMUST00000165194] [ENSMUST00000165487] [ENSMUST00000167491] [ENSMUST00000169665]
Predicted Effect probably benign
Transcript: ENSMUST00000026583
SMART Domains Protein: ENSMUSP00000026583
Gene: ENSMUSG00000025509

DomainStartEndE-ValueType
Pfam:Patatin 10 69 4.5e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000053670
SMART Domains Protein: ENSMUSP00000055899
Gene: ENSMUSG00000048200

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
EFh 32 60 2.71e0 SMART
EFh 66 94 2.63e0 SMART
low complexity region 108 126 N/A INTRINSIC
coiled coil region 167 312 N/A INTRINSIC
low complexity region 324 346 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000064151
AA Change: S87P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000065116
Gene: ENSMUSG00000025509
AA Change: S87P

DomainStartEndE-ValueType
Pfam:Patatin 10 179 1.8e-15 PFAM
low complexity region 409 425 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000097947
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163674
Predicted Effect probably damaging
Transcript: ENSMUST00000164016
AA Change: S87P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127149
Gene: ENSMUSG00000025509
AA Change: S87P

DomainStartEndE-ValueType
Pfam:Patatin 10 179 3.3e-15 PFAM
low complexity region 243 287 N/A INTRINSIC
low complexity region 465 481 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164924
SMART Domains Protein: ENSMUSP00000129632
Gene: ENSMUSG00000025509

DomainStartEndE-ValueType
Pfam:Patatin 10 69 4.5e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165194
Predicted Effect probably damaging
Transcript: ENSMUST00000165487
AA Change: S34P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000167491
SMART Domains Protein: ENSMUSP00000127957
Gene: ENSMUSG00000048200

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
EFh 32 60 2.71e0 SMART
EFh 66 94 2.63e0 SMART
low complexity region 108 126 N/A INTRINSIC
coiled coil region 167 219 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167900
Predicted Effect probably damaging
Transcript: ENSMUST00000169665
AA Change: S87P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127983
Gene: ENSMUSG00000025509
AA Change: S87P

DomainStartEndE-ValueType
Pfam:Patatin 10 249 3.4e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169723
Meta Mutation Damage Score 0.9183 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme which catalyzes the first step in the hydrolysis of triglycerides in adipose tissue. Mutations in this gene are associated with neutral lipid storage disease with myopathy. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for this targeted mutation have defects in lipolysis and altered energy metabolism. Triglyceride accumulation in cardiac muscle leads to severe cardiac dysfunction and mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430531B16Rik A G 7: 139,978,130 I51T probably damaging Het
Abca1 C A 4: 53,062,568 C1429F possibly damaging Het
Acacb A G 5: 114,226,831 E1524G probably damaging Het
Ankrd50 A G 3: 38,455,941 V759A probably damaging Het
Ano9 T C 7: 141,104,138 Q538R probably damaging Het
Bnip2 A G 9: 69,997,162 D67G probably benign Het
Cacna1e A T 1: 154,402,027 S2060T possibly damaging Het
Cand2 G A 6: 115,791,259 C455Y probably damaging Het
Cdh16 T C 8: 104,618,559 D366G probably damaging Het
Cep170b A G 12: 112,744,718 R595G probably damaging Het
Chaf1a G A 17: 56,065,184 R784Q probably damaging Het
Clca4a C A 3: 144,954,969 S698I probably damaging Het
Dnah5 A C 15: 28,289,250 Y1195S probably benign Het
Dysf T C 6: 84,137,326 I1229T probably damaging Het
Eef2 GCCC GCCCC 10: 81,178,767 probably null Het
Ep300 T C 15: 81,649,009 S1756P unknown Het
Ep300 T A 15: 81,611,410 probably benign Het
F3 A G 3: 121,734,114 I254V probably benign Het
Fam166a T C 2: 25,220,288 S71P probably benign Het
Frmd4a C A 2: 4,603,679 A786E possibly damaging Het
Fsd1l T C 4: 53,686,397 F270S probably damaging Het
Galnt3 T C 2: 66,097,859 Y231C probably benign Het
Gm10220 A C 5: 26,117,871 I181S probably benign Het
Gm13178 A C 4: 144,703,753 I222S probably damaging Het
Gnb5 G A 9: 75,343,541 V316I possibly damaging Het
Gys2 A G 6: 142,454,510 F325S possibly damaging Het
Hmgn2 G A 4: 133,967,357 probably benign Het
Hsph1 A G 5: 149,618,843 V705A probably benign Het
Ighg2b T C 12: 113,306,892 E206G unknown Het
Iqub A T 6: 24,501,291 I220N probably damaging Het
Jmjd1c A G 10: 67,249,750 T2259A probably damaging Het
Kcnq3 T C 15: 66,286,214 K4R unknown Het
Klk12 A G 7: 43,773,243 D198G probably damaging Het
L3mbtl2 G A 15: 81,686,285 E655K probably benign Het
Lrp1b C T 2: 40,821,719 C3163Y probably damaging Het
Map3k19 T A 1: 127,822,813 R934* probably null Het
Map4 A G 9: 110,081,421 T1061A possibly damaging Het
Mbnl1 G A 3: 60,529,778 V50I probably damaging Het
Med15 G A 16: 17,674,515 Q132* probably null Het
Mef2a T C 7: 67,240,439 N131S probably benign Het
Mtmr3 G C 11: 4,497,375 L361V probably damaging Het
Myo5a A G 9: 75,217,545 E1792G probably damaging Het
Nup88 C A 11: 70,969,717 A55S probably damaging Het
Olfr1252 T C 2: 89,722,043 K23E possibly damaging Het
Olfr374 T A 8: 72,110,323 Y252* probably null Het
Pacs1 G T 19: 5,143,833 S556* probably null Het
Parp4 A G 14: 56,590,410 E206G probably benign Het
Paxbp1 T G 16: 91,015,154 K889N probably damaging Het
Pcdhga2 G A 18: 37,669,249 A49T possibly damaging Het
Pcsk6 T A 7: 65,959,266 L292* probably null Het
Plb1 C T 5: 32,247,557 Q20* probably null Het
Plec C A 15: 76,184,069 Q1142H possibly damaging Het
Prss28 T C 17: 25,310,105 V140A probably damaging Het
Rad17 A T 13: 100,633,278 S258T probably damaging Het
Rnf111 A T 9: 70,429,584 C932* probably null Het
Sdc2 T C 15: 33,017,132 Y31H probably damaging Het
Selenoh T C 2: 84,670,331 E55G possibly damaging Het
Serpina3k T G 12: 104,344,192 V327G possibly damaging Het
Setd1b A G 5: 123,148,616 E575G unknown Het
Slco1a4 A T 6: 141,819,540 S325R probably damaging Het
Smtnl1 C A 2: 84,818,443 V156L possibly damaging Het
Speg A G 1: 75,415,395 D1607G probably damaging Het
Tctex1d4 A G 4: 117,128,615 T212A possibly damaging Het
Tmem101 T A 11: 102,155,837 M69L possibly damaging Het
Treh G A 9: 44,685,911 M542I probably benign Het
Trim30b T C 7: 104,357,331 Y106C possibly damaging Het
Ttc6 T C 12: 57,576,655 I280T probably benign Het
Ubtfl1 A G 9: 18,409,493 T106A probably damaging Het
Wdr27 T C 17: 14,903,462 H583R probably benign Het
Xirp2 C T 2: 67,513,897 P2161S probably damaging Het
Other mutations in Pnpla2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02267:Pnpla2 APN 7 141458209 missense probably damaging 1.00
IGL02622:Pnpla2 APN 7 141455372 missense probably damaging 1.00
R0334:Pnpla2 UTSW 7 141459520 unclassified probably null
R1145:Pnpla2 UTSW 7 141455416 missense probably damaging 1.00
R1145:Pnpla2 UTSW 7 141455416 missense probably damaging 1.00
R1171:Pnpla2 UTSW 7 141458881 missense probably benign 0.05
R1435:Pnpla2 UTSW 7 141457411 missense probably benign 0.00
R1774:Pnpla2 UTSW 7 141459568 missense probably damaging 0.96
R1866:Pnpla2 UTSW 7 141455416 missense probably damaging 1.00
R1967:Pnpla2 UTSW 7 141459432 missense probably benign 0.21
R2153:Pnpla2 UTSW 7 141459219 missense probably damaging 1.00
R2443:Pnpla2 UTSW 7 141458069 missense possibly damaging 0.73
R2923:Pnpla2 UTSW 7 141455467 missense probably benign 0.15
R2964:Pnpla2 UTSW 7 141458478 missense probably damaging 1.00
R2966:Pnpla2 UTSW 7 141458478 missense probably damaging 1.00
R4576:Pnpla2 UTSW 7 141457344 missense probably damaging 1.00
R4646:Pnpla2 UTSW 7 141458661 missense possibly damaging 0.69
R4677:Pnpla2 UTSW 7 141458443 missense probably damaging 1.00
R4934:Pnpla2 UTSW 7 141458172 missense probably damaging 1.00
R5011:Pnpla2 UTSW 7 141459291 critical splice donor site probably null
R5334:Pnpla2 UTSW 7 141459493 missense probably damaging 0.97
R6331:Pnpla2 UTSW 7 141459285 missense probably damaging 0.99
R7361:Pnpla2 UTSW 7 141457431 missense possibly damaging 0.77
R8066:Pnpla2 UTSW 7 141459668 makesense probably null
X0020:Pnpla2 UTSW 7 141459660 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CATAGGTGTCTTCACAGTCAATGG -3'
(R):5'- TTGAGTTAACTCCCTGCCGC -3'

Sequencing Primer
(F):5'- GGAATGTCATCCATCTGAGTATATCC -3'
(R):5'- AACACGGTGTCTGCAGTG -3'
Posted On2015-09-24