Incidental Mutation 'R4577:Rnf111'
ID342562
Institutional Source Beutler Lab
Gene Symbol Rnf111
Ensembl Gene ENSMUSG00000032217
Gene Namering finger 111
SynonymsArkadia
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4577 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location70425424-70503725 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 70429584 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 932 (C932*)
Ref Sequence ENSEMBL: ENSMUSP00000149445 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034739] [ENSMUST00000113595] [ENSMUST00000213647] [ENSMUST00000215848]
Predicted Effect probably null
Transcript: ENSMUST00000034739
AA Change: C940*
SMART Domains Protein: ENSMUSP00000034739
Gene: ENSMUSG00000032217
AA Change: C940*

DomainStartEndE-ValueType
Pfam:RNF111_N 18 290 2.5e-112 PFAM
low complexity region 340 355 N/A INTRINSIC
low complexity region 503 518 N/A INTRINSIC
low complexity region 623 632 N/A INTRINSIC
low complexity region 692 707 N/A INTRINSIC
low complexity region 744 758 N/A INTRINSIC
low complexity region 759 776 N/A INTRINSIC
low complexity region 820 837 N/A INTRINSIC
low complexity region 924 935 N/A INTRINSIC
RING 937 977 3e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000113595
AA Change: C940*
SMART Domains Protein: ENSMUSP00000109225
Gene: ENSMUSG00000032217
AA Change: C940*

DomainStartEndE-ValueType
Pfam:RNF111_N 18 290 1.8e-97 PFAM
low complexity region 340 355 N/A INTRINSIC
low complexity region 503 518 N/A INTRINSIC
low complexity region 623 632 N/A INTRINSIC
low complexity region 692 707 N/A INTRINSIC
low complexity region 744 758 N/A INTRINSIC
low complexity region 759 776 N/A INTRINSIC
low complexity region 820 837 N/A INTRINSIC
low complexity region 924 935 N/A INTRINSIC
RING 937 977 3e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213208
Predicted Effect probably null
Transcript: ENSMUST00000213647
AA Change: C931*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213996
Predicted Effect probably null
Transcript: ENSMUST00000215848
AA Change: C932*
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear RING-domain containing E3 ubiquitin ligase. This protein interacts with the transforming growth factor (TGF) -beta/NODAL signaling pathway by promoting the ubiquitination and proteosomal degradation of negative regulators, like SMAD proteins, and thereby enhances TGF-beta target-gene transcription. As a modulator of the nodal signaling cascade, this gene plays a critical role in the induction of mesoderm during embryonic development. Alternative splicing of this gene results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a gene trap allele fail to develop anterior structures and midline with failure to develop anterior endoderm, node and mesendoderm. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430531B16Rik A G 7: 139,978,130 I51T probably damaging Het
Abca1 C A 4: 53,062,568 C1429F possibly damaging Het
Acacb A G 5: 114,226,831 E1524G probably damaging Het
Ankrd50 A G 3: 38,455,941 V759A probably damaging Het
Ano9 T C 7: 141,104,138 Q538R probably damaging Het
Bnip2 A G 9: 69,997,162 D67G probably benign Het
Cacna1e A T 1: 154,402,027 S2060T possibly damaging Het
Cand2 G A 6: 115,791,259 C455Y probably damaging Het
Cdh16 T C 8: 104,618,559 D366G probably damaging Het
Cep170b A G 12: 112,744,718 R595G probably damaging Het
Chaf1a G A 17: 56,065,184 R784Q probably damaging Het
Clca4a C A 3: 144,954,969 S698I probably damaging Het
Dnah5 A C 15: 28,289,250 Y1195S probably benign Het
Dysf T C 6: 84,137,326 I1229T probably damaging Het
Eef2 GCCC GCCCC 10: 81,178,767 probably null Het
Ep300 T C 15: 81,649,009 S1756P unknown Het
Ep300 T A 15: 81,611,410 probably benign Het
F3 A G 3: 121,734,114 I254V probably benign Het
Fam166a T C 2: 25,220,288 S71P probably benign Het
Frmd4a C A 2: 4,603,679 A786E possibly damaging Het
Fsd1l T C 4: 53,686,397 F270S probably damaging Het
Galnt3 T C 2: 66,097,859 Y231C probably benign Het
Gm10220 A C 5: 26,117,871 I181S probably benign Het
Gm13178 A C 4: 144,703,753 I222S probably damaging Het
Gnb5 G A 9: 75,343,541 V316I possibly damaging Het
Gys2 A G 6: 142,454,510 F325S possibly damaging Het
Hmgn2 G A 4: 133,967,357 probably benign Het
Hsph1 A G 5: 149,618,843 V705A probably benign Het
Ighg2b T C 12: 113,306,892 E206G unknown Het
Iqub A T 6: 24,501,291 I220N probably damaging Het
Jmjd1c A G 10: 67,249,750 T2259A probably damaging Het
Kcnq3 T C 15: 66,286,214 K4R unknown Het
Klk12 A G 7: 43,773,243 D198G probably damaging Het
L3mbtl2 G A 15: 81,686,285 E655K probably benign Het
Lrp1b C T 2: 40,821,719 C3163Y probably damaging Het
Map3k19 T A 1: 127,822,813 R934* probably null Het
Map4 A G 9: 110,081,421 T1061A possibly damaging Het
Mbnl1 G A 3: 60,529,778 V50I probably damaging Het
Med15 G A 16: 17,674,515 Q132* probably null Het
Mef2a T C 7: 67,240,439 N131S probably benign Het
Mtmr3 G C 11: 4,497,375 L361V probably damaging Het
Myo5a A G 9: 75,217,545 E1792G probably damaging Het
Nup88 C A 11: 70,969,717 A55S probably damaging Het
Olfr1252 T C 2: 89,722,043 K23E possibly damaging Het
Olfr374 T A 8: 72,110,323 Y252* probably null Het
Pacs1 G T 19: 5,143,833 S556* probably null Het
Parp4 A G 14: 56,590,410 E206G probably benign Het
Paxbp1 T G 16: 91,015,154 K889N probably damaging Het
Pcdhga2 G A 18: 37,669,249 A49T possibly damaging Het
Pcsk6 T A 7: 65,959,266 L292* probably null Het
Plb1 C T 5: 32,247,557 Q20* probably null Het
Plec C A 15: 76,184,069 Q1142H possibly damaging Het
Pnpla2 T C 7: 141,457,344 S87P probably damaging Het
Prss28 T C 17: 25,310,105 V140A probably damaging Het
Rad17 A T 13: 100,633,278 S258T probably damaging Het
Sdc2 T C 15: 33,017,132 Y31H probably damaging Het
Selenoh T C 2: 84,670,331 E55G possibly damaging Het
Serpina3k T G 12: 104,344,192 V327G possibly damaging Het
Setd1b A G 5: 123,148,616 E575G unknown Het
Slco1a4 A T 6: 141,819,540 S325R probably damaging Het
Smtnl1 C A 2: 84,818,443 V156L possibly damaging Het
Speg A G 1: 75,415,395 D1607G probably damaging Het
Tctex1d4 A G 4: 117,128,615 T212A possibly damaging Het
Tmem101 T A 11: 102,155,837 M69L possibly damaging Het
Treh G A 9: 44,685,911 M542I probably benign Het
Trim30b T C 7: 104,357,331 Y106C possibly damaging Het
Ttc6 T C 12: 57,576,655 I280T probably benign Het
Ubtfl1 A G 9: 18,409,493 T106A probably damaging Het
Wdr27 T C 17: 14,903,462 H583R probably benign Het
Xirp2 C T 2: 67,513,897 P2161S probably damaging Het
Other mutations in Rnf111
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02473:Rnf111 APN 9 70440858 missense probably damaging 1.00
IGL02567:Rnf111 APN 9 70459005 missense probably damaging 1.00
R0052:Rnf111 UTSW 9 70476389 missense probably benign 0.00
R0245:Rnf111 UTSW 9 70453831 splice site probably benign
R0760:Rnf111 UTSW 9 70429678 missense probably damaging 1.00
R1327:Rnf111 UTSW 9 70453816 missense possibly damaging 0.60
R1778:Rnf111 UTSW 9 70476112 missense probably benign 0.00
R1884:Rnf111 UTSW 9 70476238 missense probably damaging 0.99
R1892:Rnf111 UTSW 9 70476374 missense probably damaging 1.00
R2261:Rnf111 UTSW 9 70476391 missense probably benign
R2762:Rnf111 UTSW 9 70476045 missense possibly damaging 0.82
R3980:Rnf111 UTSW 9 70442325 missense probably damaging 1.00
R4631:Rnf111 UTSW 9 70450396 missense probably benign 0.07
R4804:Rnf111 UTSW 9 70430957 missense possibly damaging 0.70
R5153:Rnf111 UTSW 9 70476140 missense probably benign 0.35
R5500:Rnf111 UTSW 9 70476043 missense possibly damaging 0.94
R5546:Rnf111 UTSW 9 70459096 missense probably benign 0.05
R5975:Rnf111 UTSW 9 70429580 missense probably damaging 1.00
R6395:Rnf111 UTSW 9 70476410 missense possibly damaging 0.95
R6482:Rnf111 UTSW 9 70429607 missense probably damaging 1.00
R7056:Rnf111 UTSW 9 70453675 missense possibly damaging 0.60
R7239:Rnf111 UTSW 9 70469373 missense probably damaging 1.00
R7444:Rnf111 UTSW 9 70440843 missense probably damaging 1.00
R7618:Rnf111 UTSW 9 70503332 start gained probably benign
Predicted Primers PCR Primer
(F):5'- GTGACCAGTTGATCCATTTGTGAATC -3'
(R):5'- ACTGTTGACTTCCAGGAGTCAG -3'

Sequencing Primer
(F):5'- GAATCAATCACCTATCTGTGGTGCTG -3'
(R):5'- CTTCCAGGAGTCAGTAATTAATTGG -3'
Posted On2015-09-24