Incidental Mutation 'R4577:Jmjd1c'
ID342565
Institutional Source Beutler Lab
Gene Symbol Jmjd1c
Ensembl Gene ENSMUSG00000037876
Gene Namejumonji domain containing 1C
SynonymsTRIP8, D630035I23Rik, 5430433L24Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.652) question?
Stock #R4577 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location67096125-67256326 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 67249750 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 2259 (T2259A)
Ref Sequence ENSEMBL: ENSMUSP00000133700 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051446] [ENSMUST00000173689] [ENSMUST00000174408]
Predicted Effect probably damaging
Transcript: ENSMUST00000051446
AA Change: T2439A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000056227
Gene: ENSMUSG00000037876
AA Change: T2439A

DomainStartEndE-ValueType
Blast:JmjC 143 2236 N/A BLAST
JmjC 2264 2488 3.29e-53 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173236
Predicted Effect probably damaging
Transcript: ENSMUST00000173689
AA Change: T2259A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133700
Gene: ENSMUSG00000037876
AA Change: T2259A

DomainStartEndE-ValueType
Blast:JmjC 1 2056 N/A BLAST
JmjC 2084 2308 3.29e-53 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173762
Predicted Effect probably damaging
Transcript: ENSMUST00000174408
AA Change: T2440A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134551
Gene: ENSMUSG00000037876
AA Change: T2440A

DomainStartEndE-ValueType
Blast:JmjC 143 2237 N/A BLAST
JmjC 2265 2489 3.29e-53 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with thyroid hormone receptors and contains a jumonji domain. It is a candidate histone demethylase and is thought to be a coactivator for key transcription factors. It plays a role in the DNA-damage response pathway by demethylating the mediator of DNA damage checkpoint 1 (MDC1) protein, and is required for the survival of acute myeloid leukemia. Mutations in this gene are associated with Rett syndrome and intellectual disability. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit an age-dependent male infertility phenotype, characterized by early loss of undifferentiated spermatogonia, and a progressive reduction in testis size/weight and male germ cells, partly due to increased male germ cell apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430531B16Rik A G 7: 139,978,130 I51T probably damaging Het
Abca1 C A 4: 53,062,568 C1429F possibly damaging Het
Acacb A G 5: 114,226,831 E1524G probably damaging Het
Ankrd50 A G 3: 38,455,941 V759A probably damaging Het
Ano9 T C 7: 141,104,138 Q538R probably damaging Het
Bnip2 A G 9: 69,997,162 D67G probably benign Het
Cacna1e A T 1: 154,402,027 S2060T possibly damaging Het
Cand2 G A 6: 115,791,259 C455Y probably damaging Het
Cdh16 T C 8: 104,618,559 D366G probably damaging Het
Cep170b A G 12: 112,744,718 R595G probably damaging Het
Chaf1a G A 17: 56,065,184 R784Q probably damaging Het
Clca4a C A 3: 144,954,969 S698I probably damaging Het
Dnah5 A C 15: 28,289,250 Y1195S probably benign Het
Dysf T C 6: 84,137,326 I1229T probably damaging Het
Eef2 GCCC GCCCC 10: 81,178,767 probably null Het
Ep300 T C 15: 81,649,009 S1756P unknown Het
Ep300 T A 15: 81,611,410 probably benign Het
F3 A G 3: 121,734,114 I254V probably benign Het
Fam166a T C 2: 25,220,288 S71P probably benign Het
Frmd4a C A 2: 4,603,679 A786E possibly damaging Het
Fsd1l T C 4: 53,686,397 F270S probably damaging Het
Galnt3 T C 2: 66,097,859 Y231C probably benign Het
Gm10220 A C 5: 26,117,871 I181S probably benign Het
Gm13178 A C 4: 144,703,753 I222S probably damaging Het
Gnb5 G A 9: 75,343,541 V316I possibly damaging Het
Gys2 A G 6: 142,454,510 F325S possibly damaging Het
Hmgn2 G A 4: 133,967,357 probably benign Het
Hsph1 A G 5: 149,618,843 V705A probably benign Het
Ighg2b T C 12: 113,306,892 E206G unknown Het
Iqub A T 6: 24,501,291 I220N probably damaging Het
Kcnq3 T C 15: 66,286,214 K4R unknown Het
Klk12 A G 7: 43,773,243 D198G probably damaging Het
L3mbtl2 G A 15: 81,686,285 E655K probably benign Het
Lrp1b C T 2: 40,821,719 C3163Y probably damaging Het
Map3k19 T A 1: 127,822,813 R934* probably null Het
Map4 A G 9: 110,081,421 T1061A possibly damaging Het
Mbnl1 G A 3: 60,529,778 V50I probably damaging Het
Med15 G A 16: 17,674,515 Q132* probably null Het
Mef2a T C 7: 67,240,439 N131S probably benign Het
Mtmr3 G C 11: 4,497,375 L361V probably damaging Het
Myo5a A G 9: 75,217,545 E1792G probably damaging Het
Nup88 C A 11: 70,969,717 A55S probably damaging Het
Olfr1252 T C 2: 89,722,043 K23E possibly damaging Het
Olfr374 T A 8: 72,110,323 Y252* probably null Het
Pacs1 G T 19: 5,143,833 S556* probably null Het
Parp4 A G 14: 56,590,410 E206G probably benign Het
Paxbp1 T G 16: 91,015,154 K889N probably damaging Het
Pcdhga2 G A 18: 37,669,249 A49T possibly damaging Het
Pcsk6 T A 7: 65,959,266 L292* probably null Het
Plb1 C T 5: 32,247,557 Q20* probably null Het
Plec C A 15: 76,184,069 Q1142H possibly damaging Het
Pnpla2 T C 7: 141,457,344 S87P probably damaging Het
Prss28 T C 17: 25,310,105 V140A probably damaging Het
Rad17 A T 13: 100,633,278 S258T probably damaging Het
Rnf111 A T 9: 70,429,584 C932* probably null Het
Sdc2 T C 15: 33,017,132 Y31H probably damaging Het
Selenoh T C 2: 84,670,331 E55G possibly damaging Het
Serpina3k T G 12: 104,344,192 V327G possibly damaging Het
Setd1b A G 5: 123,148,616 E575G unknown Het
Slco1a4 A T 6: 141,819,540 S325R probably damaging Het
Smtnl1 C A 2: 84,818,443 V156L possibly damaging Het
Speg A G 1: 75,415,395 D1607G probably damaging Het
Tctex1d4 A G 4: 117,128,615 T212A possibly damaging Het
Tmem101 T A 11: 102,155,837 M69L possibly damaging Het
Treh G A 9: 44,685,911 M542I probably benign Het
Trim30b T C 7: 104,357,331 Y106C possibly damaging Het
Ttc6 T C 12: 57,576,655 I280T probably benign Het
Ubtfl1 A G 9: 18,409,493 T106A probably damaging Het
Wdr27 T C 17: 14,903,462 H583R probably benign Het
Xirp2 C T 2: 67,513,897 P2161S probably damaging Het
Other mutations in Jmjd1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01062:Jmjd1c APN 10 67226715 missense probably damaging 1.00
IGL01604:Jmjd1c APN 10 67249762 missense probably damaging 1.00
IGL01753:Jmjd1c APN 10 67232015 missense probably damaging 1.00
IGL02081:Jmjd1c APN 10 67219526 missense probably benign 0.02
IGL02128:Jmjd1c APN 10 67243869 missense probably damaging 1.00
IGL02134:Jmjd1c APN 10 67220392 missense possibly damaging 0.87
IGL02215:Jmjd1c APN 10 67220322 missense probably damaging 1.00
IGL02408:Jmjd1c APN 10 67226382 missense probably benign 0.00
IGL02502:Jmjd1c APN 10 67225861 missense probably benign 0.13
IGL02546:Jmjd1c APN 10 67225336 missense possibly damaging 0.94
IGL02943:Jmjd1c APN 10 67219654 missense probably damaging 0.99
IGL03171:Jmjd1c APN 10 67225498 missense possibly damaging 0.89
IGL03261:Jmjd1c APN 10 67232070 missense probably damaging 0.99
accordion UTSW 10 67233414 missense probably damaging 0.99
PIT4378001:Jmjd1c UTSW 10 67229913 missense probably damaging 1.00
R0126:Jmjd1c UTSW 10 67219326 missense probably damaging 0.98
R0133:Jmjd1c UTSW 10 67240808 missense probably benign 0.22
R0201:Jmjd1c UTSW 10 67219109 missense unknown
R0396:Jmjd1c UTSW 10 67219523 missense possibly damaging 0.82
R0401:Jmjd1c UTSW 10 67220382 missense probably damaging 1.00
R0452:Jmjd1c UTSW 10 67255482 missense probably benign 0.28
R0488:Jmjd1c UTSW 10 67240727 missense probably damaging 0.99
R0504:Jmjd1c UTSW 10 67225755 missense probably damaging 1.00
R0555:Jmjd1c UTSW 10 67225789 missense probably benign 0.01
R0673:Jmjd1c UTSW 10 67226809 missense probably damaging 1.00
R0718:Jmjd1c UTSW 10 67218946 splice site probably null
R0755:Jmjd1c UTSW 10 67096599 intron probably benign
R1142:Jmjd1c UTSW 10 67225345 missense probably damaging 1.00
R1196:Jmjd1c UTSW 10 67239236 splice site probably benign
R1413:Jmjd1c UTSW 10 67249750 missense probably damaging 1.00
R1619:Jmjd1c UTSW 10 67219875 missense probably benign 0.25
R1676:Jmjd1c UTSW 10 67224809 missense probably benign 0.02
R1751:Jmjd1c UTSW 10 67225690 missense probably benign
R1950:Jmjd1c UTSW 10 67239922 missense possibly damaging 0.71
R1968:Jmjd1c UTSW 10 67225440 missense probably damaging 1.00
R2049:Jmjd1c UTSW 10 67157998 nonsense probably null
R2061:Jmjd1c UTSW 10 67218426 missense probably damaging 1.00
R2202:Jmjd1c UTSW 10 67239463 splice site probably null
R2203:Jmjd1c UTSW 10 67239463 splice site probably null
R2256:Jmjd1c UTSW 10 67225294 missense probably damaging 1.00
R2312:Jmjd1c UTSW 10 67238850 missense probably damaging 0.98
R2349:Jmjd1c UTSW 10 67255500 missense probably benign
R2392:Jmjd1c UTSW 10 67229904 missense probably damaging 1.00
R3015:Jmjd1c UTSW 10 67157932 missense probably damaging 1.00
R3110:Jmjd1c UTSW 10 67240084 splice site probably benign
R4043:Jmjd1c UTSW 10 67219466 missense possibly damaging 0.55
R4097:Jmjd1c UTSW 10 67219008 missense probably benign 0.09
R4118:Jmjd1c UTSW 10 67219753 missense probably damaging 0.96
R4193:Jmjd1c UTSW 10 67096681 intron probably benign
R4352:Jmjd1c UTSW 10 67244809 missense probably damaging 1.00
R4630:Jmjd1c UTSW 10 67157974 nonsense probably null
R4717:Jmjd1c UTSW 10 67158051 nonsense probably null
R4741:Jmjd1c UTSW 10 67224939 missense possibly damaging 0.56
R4774:Jmjd1c UTSW 10 67224792 missense possibly damaging 0.45
R4836:Jmjd1c UTSW 10 67233446 missense probably benign 0.21
R4914:Jmjd1c UTSW 10 67218971 missense probably damaging 1.00
R4939:Jmjd1c UTSW 10 67246137 missense possibly damaging 0.93
R5211:Jmjd1c UTSW 10 67232016 missense probably damaging 1.00
R5215:Jmjd1c UTSW 10 67240701 missense possibly damaging 0.93
R5514:Jmjd1c UTSW 10 67218149 missense probably damaging 1.00
R5530:Jmjd1c UTSW 10 67249762 missense probably damaging 1.00
R5624:Jmjd1c UTSW 10 67233414 missense probably damaging 0.99
R5640:Jmjd1c UTSW 10 67226078 missense probably benign 0.10
R5654:Jmjd1c UTSW 10 67230006 missense probably benign 0.10
R5742:Jmjd1c UTSW 10 67220333 missense probably benign 0.02
R5764:Jmjd1c UTSW 10 67226512 missense probably damaging 1.00
R6118:Jmjd1c UTSW 10 67240012 missense probably damaging 1.00
R6163:Jmjd1c UTSW 10 67248048 missense possibly damaging 0.46
R6256:Jmjd1c UTSW 10 67220408 missense probably damaging 1.00
R6266:Jmjd1c UTSW 10 67249660 missense probably damaging 0.96
R6358:Jmjd1c UTSW 10 67225939 missense probably benign
R6430:Jmjd1c UTSW 10 67224160 missense possibly damaging 0.87
R6455:Jmjd1c UTSW 10 67226016 missense probably benign 0.10
R6887:Jmjd1c UTSW 10 67189820 missense possibly damaging 0.74
R6895:Jmjd1c UTSW 10 67217090 missense probably benign 0.00
R7041:Jmjd1c UTSW 10 67220609 missense possibly damaging 0.90
R7095:Jmjd1c UTSW 10 67219632 missense probably benign 0.39
R7113:Jmjd1c UTSW 10 67158001 missense probably damaging 0.98
R7225:Jmjd1c UTSW 10 67226065 missense probably benign 0.00
R7249:Jmjd1c UTSW 10 67189817 missense probably benign 0.01
R7361:Jmjd1c UTSW 10 67218364 missense probably benign 0.10
R7383:Jmjd1c UTSW 10 67189758 missense probably benign 0.14
R7460:Jmjd1c UTSW 10 67217036 missense probably benign 0.24
R7475:Jmjd1c UTSW 10 67225313 missense probably benign 0.22
R7502:Jmjd1c UTSW 10 67232015 missense probably damaging 0.99
Z1088:Jmjd1c UTSW 10 67238174 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCCTAAATAACTGCAAAGTGCTG -3'
(R):5'- GGTGATGTGCATTTTCCTAAGTAAC -3'

Sequencing Primer
(F):5'- CCCAAGGATGCATTACAGATGTTGTG -3'
(R):5'- TGTGCATTTTCCTAAGTAACATTTTC -3'
Posted On2015-09-24