Mutagenetix > Incidental Mutations

Incidental Mutation 'R4577:Eef2'

342566

Institutional Source

Beutler Lab

Gene Symbol

Eef2

Ensembl Gene

ENSMUSG00000034994

Gene Name

eukaryotic translation elongation factor 2

Synonyms

Ef-2

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.969) question?

Stock #

R4577 (G1)

Quality Score

154

Status

Not validated

Chromosome

Chromosomal Location

81176631-81182498 bp(+) (GRCm38)

Type of Mutation

frame shift

DNA Base Change (assembly)

GCCC to GCCCC at 81178767 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000046101 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047665] [ENSMUST00000047864] [ENSMUST00000056086] [ENSMUST00000178422] [ENSMUST00000218157] [ENSMUST00000219133]

Predicted Effect

probably benign
Transcript: ENSMUST00000047665

SMART Domains

Protein: ENSMUSP00000035962
Gene: ENSMUSG00000034974

Domain	Start	End	E-Value	Type
S_TKc	13	275	1.93e-98	SMART
low complexity region	288	299	N/A	INTRINSIC
low complexity region	331	347	N/A	INTRINSIC
low complexity region	349	411	N/A	INTRINSIC
coiled coil region	419	444	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000047864

SMART Domains

Protein: ENSMUSP00000046101
Gene: ENSMUSG00000034994

Domain	Start	End	E-Value	Type
Pfam:GTP_EFTU	17	360	2e-65	PFAM
Pfam:MMR_HSR1	21	159	6.3e-6	PFAM
Pfam:GTP_EFTU_D2	409	486	2.3e-14	PFAM
Pfam:EFG_II	501	568	1.9e-14	PFAM
EFG_IV	621	737	5.56e-27	SMART
EFG_C	739	828	4.06e-20	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000056086

SMART Domains

Protein: ENSMUSP00000049685
Gene: ENSMUSG00000053603

Domain	Start	End	E-Value	Type
low complexity region	2	14	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000082507

Predicted Effect

probably benign
Transcript: ENSMUST00000178422

SMART Domains

Protein: ENSMUSP00000137333
Gene: ENSMUSG00000034974

Domain	Start	End	E-Value	Type
S_TKc	13	275	1.93e-98	SMART
low complexity region	288	299	N/A	INTRINSIC
low complexity region	331	347	N/A	INTRINSIC
low complexity region	349	411	N/A	INTRINSIC
coiled coil region	419	444	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000217936

Predicted Effect

probably benign
Transcript: ENSMUST00000218157

Predicted Effect

probably benign
Transcript: ENSMUST00000219133

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219329

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219497

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219943

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220076

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GTP-binding translation elongation factor family. This protein is an essential factor for protein synthesis. It promotes the GTP-dependent translocation of the nascent protein chain from the A-site to the P-site of the ribosome. This protein is completely inactivated by EF-2 kinase phosporylation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a mutation removing the diphthamide modification display partial neonatal lethality, fetal growth retardation and abnormal cell physiology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6430531B16Rik	A	G	7: 139,978,130	I51T	probably damaging	Het
Abca1	C	A	4: 53,062,568	C1429F	possibly damaging	Het
Acacb	A	G	5: 114,226,831	E1524G	probably damaging	Het
Ankrd50	A	G	3: 38,455,941	V759A	probably damaging	Het
Ano9	T	C	7: 141,104,138	Q538R	probably damaging	Het
Bnip2	A	G	9: 69,997,162	D67G	probably benign	Het
Cacna1e	A	T	1: 154,402,027	S2060T	possibly damaging	Het
Cand2	G	A	6: 115,791,259	C455Y	probably damaging	Het
Cdh16	T	C	8: 104,618,559	D366G	probably damaging	Het
Cep170b	A	G	12: 112,744,718	R595G	probably damaging	Het
Chaf1a	G	A	17: 56,065,184	R784Q	probably damaging	Het
Clca4a	C	A	3: 144,954,969	S698I	probably damaging	Het
Dnah5	A	C	15: 28,289,250	Y1195S	probably benign	Het
Dysf	T	C	6: 84,137,326	I1229T	probably damaging	Het
Ep300	T	C	15: 81,649,009	S1756P	unknown	Het
Ep300	T	A	15: 81,611,410		probably benign	Het
F3	A	G	3: 121,734,114	I254V	probably benign	Het
Fam166a	T	C	2: 25,220,288	S71P	probably benign	Het
Frmd4a	C	A	2: 4,603,679	A786E	possibly damaging	Het
Fsd1l	T	C	4: 53,686,397	F270S	probably damaging	Het
Galnt3	T	C	2: 66,097,859	Y231C	probably benign	Het
Gm10220	A	C	5: 26,117,871	I181S	probably benign	Het
Gm13178	A	C	4: 144,703,753	I222S	probably damaging	Het
Gnb5	G	A	9: 75,343,541	V316I	possibly damaging	Het
Gys2	A	G	6: 142,454,510	F325S	possibly damaging	Het
Hmgn2	G	A	4: 133,967,357		probably benign	Het
Hsph1	A	G	5: 149,618,843	V705A	probably benign	Het
Ighg2b	T	C	12: 113,306,892	E206G	unknown	Het
Iqub	A	T	6: 24,501,291	I220N	probably damaging	Het
Jmjd1c	A	G	10: 67,249,750	T2259A	probably damaging	Het
Kcnq3	T	C	15: 66,286,214	K4R	unknown	Het
Klk12	A	G	7: 43,773,243	D198G	probably damaging	Het
L3mbtl2	G	A	15: 81,686,285	E655K	probably benign	Het
Lrp1b	C	T	2: 40,821,719	C3163Y	probably damaging	Het
Map3k19	T	A	1: 127,822,813	R934*	probably null	Het
Map4	A	G	9: 110,081,421	T1061A	possibly damaging	Het
Mbnl1	G	A	3: 60,529,778	V50I	probably damaging	Het
Med15	G	A	16: 17,674,515	Q132*	probably null	Het
Mef2a	T	C	7: 67,240,439	N131S	probably benign	Het
Mtmr3	G	C	11: 4,497,375	L361V	probably damaging	Het
Myo5a	A	G	9: 75,217,545	E1792G	probably damaging	Het
Nup88	C	A	11: 70,969,717	A55S	probably damaging	Het
Olfr1252	T	C	2: 89,722,043	K23E	possibly damaging	Het
Olfr374	T	A	8: 72,110,323	Y252*	probably null	Het
Pacs1	G	T	19: 5,143,833	S556*	probably null	Het
Parp4	A	G	14: 56,590,410	E206G	probably benign	Het
Paxbp1	T	G	16: 91,015,154	K889N	probably damaging	Het
Pcdhga2	G	A	18: 37,669,249	A49T	possibly damaging	Het
Pcsk6	T	A	7: 65,959,266	L292*	probably null	Het
Plb1	C	T	5: 32,247,557	Q20*	probably null	Het
Plec	C	A	15: 76,184,069	Q1142H	possibly damaging	Het
Pnpla2	T	C	7: 141,457,344	S87P	probably damaging	Het
Prss28	T	C	17: 25,310,105	V140A	probably damaging	Het
Rad17	A	T	13: 100,633,278	S258T	probably damaging	Het
Rnf111	A	T	9: 70,429,584	C932*	probably null	Het
Sdc2	T	C	15: 33,017,132	Y31H	probably damaging	Het
Selenoh	T	C	2: 84,670,331	E55G	possibly damaging	Het
Serpina3k	T	G	12: 104,344,192	V327G	possibly damaging	Het
Setd1b	A	G	5: 123,148,616	E575G	unknown	Het
Slco1a4	A	T	6: 141,819,540	S325R	probably damaging	Het
Smtnl1	C	A	2: 84,818,443	V156L	possibly damaging	Het
Speg	A	G	1: 75,415,395	D1607G	probably damaging	Het
Tctex1d4	A	G	4: 117,128,615	T212A	possibly damaging	Het
Tmem101	T	A	11: 102,155,837	M69L	possibly damaging	Het
Treh	G	A	9: 44,685,911	M542I	probably benign	Het
Trim30b	T	C	7: 104,357,331	Y106C	possibly damaging	Het
Ttc6	T	C	12: 57,576,655	I280T	probably benign	Het
Ubtfl1	A	G	9: 18,409,493	T106A	probably damaging	Het
Wdr27	T	C	17: 14,903,462	H583R	probably benign	Het
Xirp2	C	T	2: 67,513,897	P2161S	probably damaging	Het

Other mutations in Eef2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01303:Eef2	APN	10	81181943	missense	possibly damaging	0.93
IGL01303:Eef2	APN	10	81181982	splice site	probably null
IGL01376:Eef2	APN	10	81178049	unclassified	probably benign
IGL01876:Eef2	APN	10	81180270	missense	probably benign
IGL02000:Eef2	APN	10	81180011	missense	probably benign	0.13
IGL02514:Eef2	APN	10	81179593	missense	probably benign	0.11
IGL03087:Eef2	APN	10	81181247	missense	probably benign	0.12
IGL03389:Eef2	APN	10	81179706	missense	probably benign	0.40
fig	UTSW	10	81180292	missense	possibly damaging	0.50
R0052:Eef2	UTSW	10	81178768	frame shift	probably null
R0178:Eef2	UTSW	10	81180292	missense	possibly damaging	0.50
R0445:Eef2	UTSW	10	81178770	frame shift	probably null
R0497:Eef2	UTSW	10	81181586	missense	probably benign	0.00
R0539:Eef2	UTSW	10	81178768	frame shift	probably null
R0745:Eef2	UTSW	10	81181996	missense	probably benign	0.00
R0811:Eef2	UTSW	10	81178769	frame shift	probably null
R0812:Eef2	UTSW	10	81178769	frame shift	probably null
R0832:Eef2	UTSW	10	81178769	frame shift	probably null
R1136:Eef2	UTSW	10	81178769	frame shift	probably null
R1298:Eef2	UTSW	10	81178768	frame shift	probably null
R1549:Eef2	UTSW	10	81178768	frame shift	probably null
R1550:Eef2	UTSW	10	81180847	missense	probably benign	0.04
R2869:Eef2	UTSW	10	81178767	frame shift	probably null
R2870:Eef2	UTSW	10	81178767	frame shift	probably null
R2871:Eef2	UTSW	10	81178767	frame shift	probably null
R2872:Eef2	UTSW	10	81178767	frame shift	probably null
R3408:Eef2	UTSW	10	81178767	frame shift	probably null
R3414:Eef2	UTSW	10	81177858	missense	probably damaging	0.98
R4291:Eef2	UTSW	10	81179580	missense	probably benign	0.00
R4357:Eef2	UTSW	10	81178767	frame shift	probably null
R4433:Eef2	UTSW	10	81178768	frame shift	probably null
R5154:Eef2	UTSW	10	81178767	frame shift	probably null
R5609:Eef2	UTSW	10	81178769	frame shift	probably null
R6545:Eef2	UTSW	10	81181114	missense	probably damaging	1.00
R6649:Eef2	UTSW	10	81178768	frame shift	probably null
R6650:Eef2	UTSW	10	81178768	frame shift	probably null
R7326:Eef2	UTSW	10	81181282	missense	probably benign	0.26
R7472:Eef2	UTSW	10	81179550	missense	probably benign	0.01
R7579:Eef2	UTSW	10	81178768	frame shift	probably null
R8013:Eef2	UTSW	10	81178196	missense	probably damaging	1.00
R8143:Eef2	UTSW	10	81181348	missense	probably damaging	1.00
Z1088:Eef2	UTSW	10	81181889	missense	probably damaging	1.00
Z1176:Eef2	UTSW	10	81181158	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- GGAGAGTGCTTGTGTACATTTCAC -3'
(R):5'- TTCCGTCATCATGGTGGGTC -3'

Sequencing Primer
(F):5'- CAAAACATACGTGGTCTTCAGG -3'
(R):5'- CATCATGGTGGGTCAGAGATTCCC -3'

Posted On

2015-09-24