Incidental Mutation 'R4577:Eef2'
List |< first << previous [record 15 of 71] next >> last >|
ID342566
Institutional Source Beutler Lab
Gene Symbol Eef2
Ensembl Gene ENSMUSG00000034994
Gene Nameeukaryotic translation elongation factor 2
SynonymsEf-2
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock #R4577 (G1)
Quality Score154
Status Not validated
Chromosome10
Chromosomal Location81176631-81182498 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) GCCC to GCCCC at 81178767 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000046101 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047665] [ENSMUST00000047864] [ENSMUST00000056086] [ENSMUST00000178422] [ENSMUST00000218157] [ENSMUST00000219133]
Predicted Effect probably benign
Transcript: ENSMUST00000047665
SMART Domains Protein: ENSMUSP00000035962
Gene: ENSMUSG00000034974

DomainStartEndE-ValueType
S_TKc 13 275 1.93e-98 SMART
low complexity region 288 299 N/A INTRINSIC
low complexity region 331 347 N/A INTRINSIC
low complexity region 349 411 N/A INTRINSIC
coiled coil region 419 444 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000047864
SMART Domains Protein: ENSMUSP00000046101
Gene: ENSMUSG00000034994

DomainStartEndE-ValueType
Pfam:GTP_EFTU 17 360 2e-65 PFAM
Pfam:MMR_HSR1 21 159 6.3e-6 PFAM
Pfam:GTP_EFTU_D2 409 486 2.3e-14 PFAM
Pfam:EFG_II 501 568 1.9e-14 PFAM
EFG_IV 621 737 5.56e-27 SMART
EFG_C 739 828 4.06e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000056086
SMART Domains Protein: ENSMUSP00000049685
Gene: ENSMUSG00000053603

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082507
Predicted Effect probably benign
Transcript: ENSMUST00000178422
SMART Domains Protein: ENSMUSP00000137333
Gene: ENSMUSG00000034974

DomainStartEndE-ValueType
S_TKc 13 275 1.93e-98 SMART
low complexity region 288 299 N/A INTRINSIC
low complexity region 331 347 N/A INTRINSIC
low complexity region 349 411 N/A INTRINSIC
coiled coil region 419 444 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217936
Predicted Effect probably benign
Transcript: ENSMUST00000218157
Predicted Effect probably benign
Transcript: ENSMUST00000219133
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219329
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219497
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219943
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220076
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GTP-binding translation elongation factor family. This protein is an essential factor for protein synthesis. It promotes the GTP-dependent translocation of the nascent protein chain from the A-site to the P-site of the ribosome. This protein is completely inactivated by EF-2 kinase phosporylation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a mutation removing the diphthamide modification display partial neonatal lethality, fetal growth retardation and abnormal cell physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430531B16Rik A G 7: 139,978,130 I51T probably damaging Het
Abca1 C A 4: 53,062,568 C1429F possibly damaging Het
Acacb A G 5: 114,226,831 E1524G probably damaging Het
Ankrd50 A G 3: 38,455,941 V759A probably damaging Het
Ano9 T C 7: 141,104,138 Q538R probably damaging Het
Bnip2 A G 9: 69,997,162 D67G probably benign Het
Cacna1e A T 1: 154,402,027 S2060T possibly damaging Het
Cand2 G A 6: 115,791,259 C455Y probably damaging Het
Cdh16 T C 8: 104,618,559 D366G probably damaging Het
Cep170b A G 12: 112,744,718 R595G probably damaging Het
Chaf1a G A 17: 56,065,184 R784Q probably damaging Het
Clca4a C A 3: 144,954,969 S698I probably damaging Het
Dnah5 A C 15: 28,289,250 Y1195S probably benign Het
Dysf T C 6: 84,137,326 I1229T probably damaging Het
Ep300 T C 15: 81,649,009 S1756P unknown Het
Ep300 T A 15: 81,611,410 probably benign Het
F3 A G 3: 121,734,114 I254V probably benign Het
Fam166a T C 2: 25,220,288 S71P probably benign Het
Frmd4a C A 2: 4,603,679 A786E possibly damaging Het
Fsd1l T C 4: 53,686,397 F270S probably damaging Het
Galnt3 T C 2: 66,097,859 Y231C probably benign Het
Gm10220 A C 5: 26,117,871 I181S probably benign Het
Gm13178 A C 4: 144,703,753 I222S probably damaging Het
Gnb5 G A 9: 75,343,541 V316I possibly damaging Het
Gys2 A G 6: 142,454,510 F325S possibly damaging Het
Hmgn2 G A 4: 133,967,357 probably benign Het
Hsph1 A G 5: 149,618,843 V705A probably benign Het
Ighg2b T C 12: 113,306,892 E206G unknown Het
Iqub A T 6: 24,501,291 I220N probably damaging Het
Jmjd1c A G 10: 67,249,750 T2259A probably damaging Het
Kcnq3 T C 15: 66,286,214 K4R unknown Het
Klk12 A G 7: 43,773,243 D198G probably damaging Het
L3mbtl2 G A 15: 81,686,285 E655K probably benign Het
Lrp1b C T 2: 40,821,719 C3163Y probably damaging Het
Map3k19 T A 1: 127,822,813 R934* probably null Het
Map4 A G 9: 110,081,421 T1061A possibly damaging Het
Mbnl1 G A 3: 60,529,778 V50I probably damaging Het
Med15 G A 16: 17,674,515 Q132* probably null Het
Mef2a T C 7: 67,240,439 N131S probably benign Het
Mtmr3 G C 11: 4,497,375 L361V probably damaging Het
Myo5a A G 9: 75,217,545 E1792G probably damaging Het
Nup88 C A 11: 70,969,717 A55S probably damaging Het
Olfr1252 T C 2: 89,722,043 K23E possibly damaging Het
Olfr374 T A 8: 72,110,323 Y252* probably null Het
Pacs1 G T 19: 5,143,833 S556* probably null Het
Parp4 A G 14: 56,590,410 E206G probably benign Het
Paxbp1 T G 16: 91,015,154 K889N probably damaging Het
Pcdhga2 G A 18: 37,669,249 A49T possibly damaging Het
Pcsk6 T A 7: 65,959,266 L292* probably null Het
Plb1 C T 5: 32,247,557 Q20* probably null Het
Plec C A 15: 76,184,069 Q1142H possibly damaging Het
Pnpla2 T C 7: 141,457,344 S87P probably damaging Het
Prss28 T C 17: 25,310,105 V140A probably damaging Het
Rad17 A T 13: 100,633,278 S258T probably damaging Het
Rnf111 A T 9: 70,429,584 C932* probably null Het
Sdc2 T C 15: 33,017,132 Y31H probably damaging Het
Selenoh T C 2: 84,670,331 E55G possibly damaging Het
Serpina3k T G 12: 104,344,192 V327G possibly damaging Het
Setd1b A G 5: 123,148,616 E575G unknown Het
Slco1a4 A T 6: 141,819,540 S325R probably damaging Het
Smtnl1 C A 2: 84,818,443 V156L possibly damaging Het
Speg A G 1: 75,415,395 D1607G probably damaging Het
Tctex1d4 A G 4: 117,128,615 T212A possibly damaging Het
Tmem101 T A 11: 102,155,837 M69L possibly damaging Het
Treh G A 9: 44,685,911 M542I probably benign Het
Trim30b T C 7: 104,357,331 Y106C possibly damaging Het
Ttc6 T C 12: 57,576,655 I280T probably benign Het
Ubtfl1 A G 9: 18,409,493 T106A probably damaging Het
Wdr27 T C 17: 14,903,462 H583R probably benign Het
Xirp2 C T 2: 67,513,897 P2161S probably damaging Het
Other mutations in Eef2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01303:Eef2 APN 10 81181943 missense possibly damaging 0.93
IGL01303:Eef2 APN 10 81181982 unclassified probably null
IGL01376:Eef2 APN 10 81178049 unclassified probably benign
IGL01876:Eef2 APN 10 81180270 missense probably benign
IGL02000:Eef2 APN 10 81180011 missense probably benign 0.13
IGL02514:Eef2 APN 10 81179593 missense probably benign 0.11
IGL03087:Eef2 APN 10 81181247 missense probably benign 0.12
IGL03389:Eef2 APN 10 81179706 missense probably benign 0.40
fig UTSW 10 81180292 missense possibly damaging 0.50
R0052:Eef2 UTSW 10 81178768 frame shift probably null
R0178:Eef2 UTSW 10 81180292 missense possibly damaging 0.50
R0445:Eef2 UTSW 10 81178770 frame shift probably null
R0497:Eef2 UTSW 10 81181586 missense probably benign 0.00
R0539:Eef2 UTSW 10 81178768 frame shift probably null
R0745:Eef2 UTSW 10 81181996 missense probably benign 0.00
R0811:Eef2 UTSW 10 81178769 frame shift probably null
R0812:Eef2 UTSW 10 81178769 frame shift probably null
R0832:Eef2 UTSW 10 81178769 frame shift probably null
R1136:Eef2 UTSW 10 81178769 frame shift probably null
R1298:Eef2 UTSW 10 81178768 frame shift probably null
R1549:Eef2 UTSW 10 81178768 frame shift probably null
R1550:Eef2 UTSW 10 81180847 missense probably benign 0.04
R2869:Eef2 UTSW 10 81178767 frame shift probably null
R2870:Eef2 UTSW 10 81178767 frame shift probably null
R2871:Eef2 UTSW 10 81178767 frame shift probably null
R2872:Eef2 UTSW 10 81178767 frame shift probably null
R3408:Eef2 UTSW 10 81178767 frame shift probably null
R3414:Eef2 UTSW 10 81177858 missense probably damaging 0.98
R4291:Eef2 UTSW 10 81179580 missense probably benign 0.00
R4357:Eef2 UTSW 10 81178767 frame shift probably null
R4433:Eef2 UTSW 10 81178768 frame shift probably null
R5154:Eef2 UTSW 10 81178767 frame shift probably null
R5609:Eef2 UTSW 10 81178769 frame shift probably null
R6545:Eef2 UTSW 10 81181114 missense probably damaging 1.00
R6649:Eef2 UTSW 10 81178768 frame shift probably null
R6650:Eef2 UTSW 10 81178768 frame shift probably null
R7326:Eef2 UTSW 10 81181282 missense probably benign 0.26
R7472:Eef2 UTSW 10 81179550 missense probably benign 0.01
R7579:Eef2 UTSW 10 81178768 frame shift probably null
R8013:Eef2 UTSW 10 81178196 missense probably damaging 1.00
Z1088:Eef2 UTSW 10 81181889 missense probably damaging 1.00
Z1176:Eef2 UTSW 10 81181158 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GGAGAGTGCTTGTGTACATTTCAC -3'
(R):5'- TTCCGTCATCATGGTGGGTC -3'

Sequencing Primer
(F):5'- CAAAACATACGTGGTCTTCAGG -3'
(R):5'- CATCATGGTGGGTCAGAGATTCCC -3'
Posted On2015-09-24