Incidental Mutation 'R4577:Rad17'
List |< first << previous [record 55 of 71] next >> last >|
ID342576
Institutional Source Beutler Lab
Gene Symbol Rad17
Ensembl Gene ENSMUSG00000021635
Gene NameRAD17 checkpoint clamp loader component
SynonymsMmRad24, 9430035O09Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4577 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location100617164-100651051 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 100633278 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 258 (S258T)
Ref Sequence ENSEMBL: ENSMUSP00000136292 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022136] [ENSMUST00000177848] [ENSMUST00000226050]
Predicted Effect probably damaging
Transcript: ENSMUST00000022136
AA Change: S258T

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000022136
Gene: ENSMUSG00000021635
AA Change: S258T

DomainStartEndE-ValueType
low complexity region 30 39 N/A INTRINSIC
AAA 128 280 1.1e-4 SMART
low complexity region 342 355 N/A INTRINSIC
low complexity region 552 567 N/A INTRINSIC
low complexity region 619 635 N/A INTRINSIC
low complexity region 669 687 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000177848
AA Change: S258T

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000136292
Gene: ENSMUSG00000021635
AA Change: S258T

DomainStartEndE-ValueType
low complexity region 30 39 N/A INTRINSIC
AAA 128 280 1.1e-4 SMART
low complexity region 342 355 N/A INTRINSIC
low complexity region 552 567 N/A INTRINSIC
low complexity region 619 635 N/A INTRINSIC
low complexity region 669 687 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225155
Predicted Effect probably benign
Transcript: ENSMUST00000226050
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is highly similar to the gene product of Schizosaccharomyces pombe rad17, a cell cycle checkpoint gene required for cell cycle arrest and DNA damage repair in response to DNA damage. This protein shares strong similarity with DNA replication factor C (RFC), and can form a complex with RFCs. This protein binds to chromatin prior to DNA damage and is phosphorylated by the checkpoint kinase ATR following damage. This protein recruits the RAD1-RAD9-HUS1 checkpoint protein complex onto chromatin after DNA damage, which may be required for its phosphorylation. The phosphorylation of this protein is required for the DNA-damage-induced cell cycle G2 arrest, and is thought to be a critical early event during checkpoint signaling in DNA-damaged cells. Multiple alternatively spliced transcript variants of this gene, which encode four distinct protein isoforms, have been reported. Two pseudogenes, located on chromosomes 7 and 13, have been identified. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous null mice display embryonic lethality with incomplete somite formation, abnormal bracnchial arch, liver, and heart morphology, abnormal neural tube development, and multiple hemorrhages. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430531B16Rik A G 7: 139,978,130 I51T probably damaging Het
Abca1 C A 4: 53,062,568 C1429F possibly damaging Het
Acacb A G 5: 114,226,831 E1524G probably damaging Het
Ankrd50 A G 3: 38,455,941 V759A probably damaging Het
Ano9 T C 7: 141,104,138 Q538R probably damaging Het
Bnip2 A G 9: 69,997,162 D67G probably benign Het
Cacna1e A T 1: 154,402,027 S2060T possibly damaging Het
Cand2 G A 6: 115,791,259 C455Y probably damaging Het
Cdh16 T C 8: 104,618,559 D366G probably damaging Het
Cep170b A G 12: 112,744,718 R595G probably damaging Het
Chaf1a G A 17: 56,065,184 R784Q probably damaging Het
Clca4a C A 3: 144,954,969 S698I probably damaging Het
Dnah5 A C 15: 28,289,250 Y1195S probably benign Het
Dysf T C 6: 84,137,326 I1229T probably damaging Het
Eef2 GCCC GCCCC 10: 81,178,767 probably null Het
Ep300 T A 15: 81,611,410 probably benign Het
Ep300 T C 15: 81,649,009 S1756P unknown Het
F3 A G 3: 121,734,114 I254V probably benign Het
Fam166a T C 2: 25,220,288 S71P probably benign Het
Frmd4a C A 2: 4,603,679 A786E possibly damaging Het
Fsd1l T C 4: 53,686,397 F270S probably damaging Het
Galnt3 T C 2: 66,097,859 Y231C probably benign Het
Gm10220 A C 5: 26,117,871 I181S probably benign Het
Gm13178 A C 4: 144,703,753 I222S probably damaging Het
Gnb5 G A 9: 75,343,541 V316I possibly damaging Het
Gys2 A G 6: 142,454,510 F325S possibly damaging Het
Hmgn2 G A 4: 133,967,357 probably benign Het
Hsph1 A G 5: 149,618,843 V705A probably benign Het
Ighg2b T C 12: 113,306,892 E206G unknown Het
Iqub A T 6: 24,501,291 I220N probably damaging Het
Jmjd1c A G 10: 67,249,750 T2259A probably damaging Het
Kcnq3 T C 15: 66,286,214 K4R unknown Het
Klk12 A G 7: 43,773,243 D198G probably damaging Het
L3mbtl2 G A 15: 81,686,285 E655K probably benign Het
Lrp1b C T 2: 40,821,719 C3163Y probably damaging Het
Map3k19 T A 1: 127,822,813 R934* probably null Het
Map4 A G 9: 110,081,421 T1061A possibly damaging Het
Mbnl1 G A 3: 60,529,778 V50I probably damaging Het
Med15 G A 16: 17,674,515 Q132* probably null Het
Mef2a T C 7: 67,240,439 N131S probably benign Het
Mtmr3 G C 11: 4,497,375 L361V probably damaging Het
Myo5a A G 9: 75,217,545 E1792G probably damaging Het
Nup88 C A 11: 70,969,717 A55S probably damaging Het
Olfr1252 T C 2: 89,722,043 K23E possibly damaging Het
Olfr374 T A 8: 72,110,323 Y252* probably null Het
Pacs1 G T 19: 5,143,833 S556* probably null Het
Parp4 A G 14: 56,590,410 E206G probably benign Het
Paxbp1 T G 16: 91,015,154 K889N probably damaging Het
Pcdhga2 G A 18: 37,669,249 A49T possibly damaging Het
Pcsk6 T A 7: 65,959,266 L292* probably null Het
Plb1 C T 5: 32,247,557 Q20* probably null Het
Plec C A 15: 76,184,069 Q1142H possibly damaging Het
Pnpla2 T C 7: 141,457,344 S87P probably damaging Het
Prss28 T C 17: 25,310,105 V140A probably damaging Het
Rnf111 A T 9: 70,429,584 C932* probably null Het
Sdc2 T C 15: 33,017,132 Y31H probably damaging Het
Selenoh T C 2: 84,670,331 E55G possibly damaging Het
Serpina3k T G 12: 104,344,192 V327G possibly damaging Het
Setd1b A G 5: 123,148,616 E575G unknown Het
Slco1a4 A T 6: 141,819,540 S325R probably damaging Het
Smtnl1 C A 2: 84,818,443 V156L possibly damaging Het
Speg A G 1: 75,415,395 D1607G probably damaging Het
Tctex1d4 A G 4: 117,128,615 T212A possibly damaging Het
Tmem101 T A 11: 102,155,837 M69L possibly damaging Het
Treh G A 9: 44,685,911 M542I probably benign Het
Trim30b T C 7: 104,357,331 Y106C possibly damaging Het
Ttc6 T C 12: 57,576,655 I280T probably benign Het
Ubtfl1 A G 9: 18,409,493 T106A probably damaging Het
Wdr27 T C 17: 14,903,462 H583R probably benign Het
Xirp2 C T 2: 67,513,897 P2161S probably damaging Het
Other mutations in Rad17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Rad17 APN 13 100629525 missense probably benign 0.03
IGL00422:Rad17 APN 13 100629523 missense probably damaging 0.98
IGL00478:Rad17 APN 13 100633274 missense probably damaging 1.00
IGL01328:Rad17 APN 13 100617803 missense probably benign
IGL01720:Rad17 APN 13 100622858 missense possibly damaging 0.51
IGL01874:Rad17 APN 13 100617684 utr 3 prime probably benign
IGL02305:Rad17 APN 13 100633862 critical splice donor site probably null
IGL02541:Rad17 APN 13 100633443 splice site probably benign
R0678:Rad17 UTSW 13 100645184 missense possibly damaging 0.73
R1079:Rad17 UTSW 13 100633899 missense probably benign 0.01
R1422:Rad17 UTSW 13 100645082 missense probably benign 0.18
R1730:Rad17 UTSW 13 100622806 missense probably damaging 0.97
R3946:Rad17 UTSW 13 100622863 missense possibly damaging 0.70
R4735:Rad17 UTSW 13 100619129 missense probably damaging 0.98
R5023:Rad17 UTSW 13 100645063 missense possibly damaging 0.88
R5098:Rad17 UTSW 13 100617646 makesense probably null
R5222:Rad17 UTSW 13 100633891 missense possibly damaging 0.53
R5511:Rad17 UTSW 13 100627649 missense possibly damaging 0.82
R5536:Rad17 UTSW 13 100631104 missense probably damaging 1.00
R5887:Rad17 UTSW 13 100633861 critical splice donor site probably null
R6041:Rad17 UTSW 13 100617766 missense probably benign 0.01
R6173:Rad17 UTSW 13 100622881 missense probably benign
R6342:Rad17 UTSW 13 100619136 missense probably damaging 1.00
R6465:Rad17 UTSW 13 100637080 missense probably benign 0.34
R6730:Rad17 UTSW 13 100649745 start gained probably benign
R6890:Rad17 UTSW 13 100637084 missense probably benign 0.34
R6947:Rad17 UTSW 13 100622875 missense probably damaging 1.00
R7035:Rad17 UTSW 13 100627625 missense possibly damaging 0.78
R7113:Rad17 UTSW 13 100629517 missense probably benign 0.03
R7408:Rad17 UTSW 13 100629511 nonsense probably null
R7553:Rad17 UTSW 13 100633286 missense probably damaging 1.00
R7573:Rad17 UTSW 13 100629466 missense probably damaging 0.99
RF022:Rad17 UTSW 13 100637085 missense probably damaging 1.00
Z1176:Rad17 UTSW 13 100627632 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TGCCACAGGGTTGAAACTATAAG -3'
(R):5'- GGTGTCAGTGAAGTCCAGTG -3'

Sequencing Primer
(F):5'- AAGCCAACCTGGTTTGTAGC -3'
(R):5'- GTGAAGTCCAGTGTTCTAAAACTCCG -3'
Posted On2015-09-24