Incidental Mutation 'R4588:Tnn'
ID342597
Institutional Source Beutler Lab
Gene Symbol Tnn
Ensembl Gene ENSMUSG00000026725
Gene Nametenascin N
SynonymsTnw, tenascin-W
MMRRC Submission 042007-MU
Accession Numbers

Genbank: NM_177839.3; Ensembl: ENSMUST00000039178

Is this an essential gene? Possibly non essential (E-score: 0.424) question?
Stock #R4588 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location160085029-160153580 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 160145111 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 307 (V307A)
Ref Sequence ENSEMBL: ENSMUSP00000039452 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039178] [ENSMUST00000131919]
Predicted Effect probably benign
Transcript: ENSMUST00000039178
AA Change: V307A

PolyPhen 2 Score 0.250 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000039452
Gene: ENSMUSG00000026725
AA Change: V307A

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
coiled coil region 100 132 N/A INTRINSIC
EGF_like 170 198 3.5e1 SMART
EGF 201 229 2.29e1 SMART
EGF_like 232 260 2.86e1 SMART
FN3 262 341 1.81e-8 SMART
FN3 351 432 1.08e-6 SMART
FN3 443 521 1.19e-8 SMART
FN3 531 608 2.64e-10 SMART
FN3 619 696 1.6e-9 SMART
FN3 707 784 9.04e-9 SMART
FN3 795 872 7.34e-9 SMART
FN3 883 960 9.04e-9 SMART
FN3 971 1048 1.07e-10 SMART
FN3 1059 1136 7.57e-11 SMART
FN3 1147 1224 4.59e-10 SMART
FN3 1235 1312 1.95e-4 SMART
FBG 1327 1539 1.16e-114 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131919
AA Change: V307A

PolyPhen 2 Score 0.091 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000115685
Gene: ENSMUSG00000026725
AA Change: V307A

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
coiled coil region 100 132 N/A INTRINSIC
EGF_like 170 198 3.5e1 SMART
EGF 201 229 2.29e1 SMART
EGF_like 232 260 2.86e1 SMART
FN3 262 341 1.81e-8 SMART
FN3 351 432 1.08e-6 SMART
FN3 443 521 1.19e-8 SMART
FN3 531 608 2.64e-10 SMART
FN3 619 696 1.6e-9 SMART
FN3 707 784 9.04e-9 SMART
FN3 795 872 7.57e-11 SMART
FN3 883 960 4.59e-10 SMART
FN3 971 1048 1.95e-4 SMART
FBG 1063 1275 1.16e-114 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 98% (51/52)
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 G T 10: 79,997,867 probably null Het
Abcb4 A T 5: 8,947,328 I936F probably benign Het
Adnp2 G T 18: 80,128,648 L849I probably benign Het
Atf7ip T C 6: 136,599,694 S1032P probably benign Het
Atr A C 9: 95,865,667 D334A probably benign Het
Atrip A T 9: 109,060,279 D20E probably damaging Het
Atxn7 T A 14: 14,096,268 C43* probably null Het
Cfap65 C A 1: 74,904,056 Q1603H possibly damaging Het
Cpne5 T C 17: 29,164,713 I327V probably benign Het
Ctsa T C 2: 164,834,150 S41P possibly damaging Het
Cyp4x1 A T 4: 115,108,797 L444Q probably damaging Het
Dchs1 C A 7: 105,756,041 M2431I probably benign Het
Ddi1 T A 9: 6,266,003 H122L probably benign Het
Defa21 C T 8: 21,025,648 P21S probably damaging Het
Ect2 A G 3: 27,147,000 V77A probably damaging Het
Ermap C A 4: 119,188,248 probably benign Het
Fancm G A 12: 65,118,441 probably null Het
Gcnt3 T A 9: 70,034,230 D352V probably damaging Het
Gys2 A G 6: 142,449,455 M428T possibly damaging Het
Igtp T A 11: 58,206,682 N226K probably damaging Het
Itpr2 T A 6: 146,241,196 H1675L probably benign Het
Lipo4 G A 19: 33,499,247 P367L possibly damaging Het
Lzts3 T C 2: 130,634,766 *587W probably null Het
Mast3 T A 8: 70,780,607 K300* probably null Het
Mepce G A 5: 137,785,272 T264I possibly damaging Het
Mif4gd A T 11: 115,609,546 I62N probably damaging Het
Olfr307 C T 7: 86,335,644 V251I probably benign Het
Olfr869 T A 9: 20,138,087 *324K probably null Het
Palm3 A G 8: 84,029,386 K509R probably benign Het
Pde11a T C 2: 76,029,303 T821A probably damaging Het
Pik3r5 A G 11: 68,493,261 probably benign Het
Pkhd1 T C 1: 20,200,868 T3154A probably benign Het
Ptprs A G 17: 56,425,534 Y438H probably damaging Het
Rdh8 T A 9: 20,822,729 D70E probably benign Het
Scn2a A T 2: 65,713,767 I831L possibly damaging Het
Selenoo A G 15: 89,096,718 H420R probably benign Het
Slc22a16 T C 10: 40,570,681 probably benign Het
Slc5a1 A G 5: 33,145,288 T208A probably benign Het
Sparc T C 11: 55,405,236 M121V probably benign Het
Sstr1 G T 12: 58,213,631 A347S probably benign Het
Stab1 C A 14: 31,157,445 V693F probably benign Het
Trmt1 A G 8: 84,690,753 probably benign Het
Ttc3 T C 16: 94,442,901 S1255P probably benign Het
Ube2ql1 A C 13: 69,739,157 S62A unknown Het
Vmn2r84 T A 10: 130,385,940 M804L probably damaging Het
Vps13a T C 19: 16,640,039 T3002A probably damaging Het
Vps50 A G 6: 3,562,306 E467G probably damaging Het
Other mutations in Tnn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Tnn APN 1 160125451 missense possibly damaging 0.65
IGL00433:Tnn APN 1 160098206 splice site probably benign
IGL00858:Tnn APN 1 160088392 critical splice donor site probably null
IGL00939:Tnn APN 1 160147530 missense probably damaging 1.00
IGL01569:Tnn APN 1 160120554 missense possibly damaging 0.51
IGL01591:Tnn APN 1 160125574 missense probably damaging 1.00
IGL01628:Tnn APN 1 160147602 missense possibly damaging 0.89
IGL01811:Tnn APN 1 160107135 missense probably damaging 1.00
IGL01813:Tnn APN 1 160088438 missense probably damaging 1.00
IGL02340:Tnn APN 1 160145205 missense probably benign 0.00
IGL02488:Tnn APN 1 160140593 missense probably benign 0.21
IGL02535:Tnn APN 1 160122652 splice site probably null
IGL02563:Tnn APN 1 160114553 missense probably damaging 1.00
IGL02572:Tnn APN 1 160086107 missense probably damaging 1.00
IGL02740:Tnn APN 1 160140777 splice site probably benign
IGL02818:Tnn APN 1 160116278 missense possibly damaging 0.86
IGL03284:Tnn APN 1 160125452 missense probably benign 0.01
1mM(1):Tnn UTSW 1 160097341 missense probably damaging 1.00
PIT4305001:Tnn UTSW 1 160086077 missense possibly damaging 0.91
R0023:Tnn UTSW 1 160104928 missense probably benign 0.00
R0234:Tnn UTSW 1 160088466 missense probably damaging 1.00
R0234:Tnn UTSW 1 160088466 missense probably damaging 1.00
R0316:Tnn UTSW 1 160120567 missense possibly damaging 0.93
R0492:Tnn UTSW 1 160120757 missense probably damaging 0.99
R0547:Tnn UTSW 1 160116337 intron probably benign
R1067:Tnn UTSW 1 160125398 missense probably damaging 1.00
R1563:Tnn UTSW 1 160125415 missense probably damaging 1.00
R1565:Tnn UTSW 1 160097265 missense probably damaging 1.00
R1615:Tnn UTSW 1 160118408 missense possibly damaging 0.93
R1637:Tnn UTSW 1 160147600 missense probably damaging 1.00
R1707:Tnn UTSW 1 160145144 missense probably damaging 1.00
R1758:Tnn UTSW 1 160147584 missense possibly damaging 0.61
R1797:Tnn UTSW 1 160140688 missense probably damaging 1.00
R1847:Tnn UTSW 1 160116182 missense possibly damaging 0.51
R1925:Tnn UTSW 1 160097229 missense probably damaging 1.00
R2182:Tnn UTSW 1 160140600 splice site probably null
R2196:Tnn UTSW 1 160097228 nonsense probably null
R2225:Tnn UTSW 1 160147465 missense probably damaging 1.00
R2227:Tnn UTSW 1 160147465 missense probably damaging 1.00
R2286:Tnn UTSW 1 160110509 missense possibly damaging 0.89
R2850:Tnn UTSW 1 160139287 missense probably benign 0.00
R3110:Tnn UTSW 1 160116286 missense possibly damaging 0.71
R3111:Tnn UTSW 1 160107055 missense probably damaging 0.98
R3112:Tnn UTSW 1 160116286 missense possibly damaging 0.71
R3729:Tnn UTSW 1 160146240 missense probably damaging 1.00
R4183:Tnn UTSW 1 160097355 missense probably damaging 1.00
R4439:Tnn UTSW 1 160116080 missense probably benign
R4441:Tnn UTSW 1 160116080 missense probably benign
R4646:Tnn UTSW 1 160146042 missense probably benign
R4647:Tnn UTSW 1 160146042 missense probably benign
R4648:Tnn UTSW 1 160146042 missense probably benign
R4701:Tnn UTSW 1 160147768 missense possibly damaging 0.72
R4703:Tnn UTSW 1 160116245 missense possibly damaging 0.84
R4737:Tnn UTSW 1 160146089 missense probably damaging 1.00
R4801:Tnn UTSW 1 160145033 missense possibly damaging 0.90
R4802:Tnn UTSW 1 160145033 missense possibly damaging 0.90
R4868:Tnn UTSW 1 160130873 missense possibly damaging 0.64
R4977:Tnn UTSW 1 160120618 missense probably damaging 1.00
R5011:Tnn UTSW 1 160126379 missense possibly damaging 0.89
R5026:Tnn UTSW 1 160146137 missense probably benign 0.00
R5027:Tnn UTSW 1 160145211 missense probably damaging 1.00
R5049:Tnn UTSW 1 160140738 missense probably benign 0.00
R5119:Tnn UTSW 1 160120552 missense probably damaging 0.98
R5128:Tnn UTSW 1 160122894 missense probably damaging 0.98
R5234:Tnn UTSW 1 160144999 missense possibly damaging 0.95
R5398:Tnn UTSW 1 160147522 missense probably benign 0.00
R5424:Tnn UTSW 1 160122702 missense possibly damaging 0.69
R5452:Tnn UTSW 1 160110261 missense probably benign 0.13
R5466:Tnn UTSW 1 160120536 missense possibly damaging 0.93
R6022:Tnn UTSW 1 160110358 missense probably benign 0.00
R6062:Tnn UTSW 1 160098278 missense probably damaging 1.00
R6086:Tnn UTSW 1 160086120 missense probably damaging 1.00
R6132:Tnn UTSW 1 160146071 missense probably damaging 0.96
R6324:Tnn UTSW 1 160145204 missense probably damaging 0.96
R6455:Tnn UTSW 1 160114719 missense probably damaging 1.00
R6563:Tnn UTSW 1 160088398 missense probably damaging 1.00
R6650:Tnn UTSW 1 160114583 missense probably damaging 1.00
R6806:Tnn UTSW 1 160120708 missense possibly damaging 0.95
R6810:Tnn UTSW 1 160104842 missense probably damaging 1.00
R7157:Tnn UTSW 1 160126377 nonsense probably null
R7243:Tnn UTSW 1 160107117 missense probably benign 0.07
R7340:Tnn UTSW 1 160146022 missense probably damaging 0.98
R7472:Tnn UTSW 1 160110347 missense probably benign 0.12
R7502:Tnn UTSW 1 160110359 missense probably benign 0.00
R7527:Tnn UTSW 1 160118504 missense possibly damaging 0.51
R7608:Tnn UTSW 1 160088414 nonsense probably null
R7746:Tnn UTSW 1 160114685 missense probably damaging 0.97
R8096:Tnn UTSW 1 160122841 missense probably damaging 1.00
R8136:Tnn UTSW 1 160107060 missense probably damaging 0.96
R8191:Tnn UTSW 1 160125518 missense probably damaging 1.00
R8334:Tnn UTSW 1 160118483 missense probably damaging 1.00
R8335:Tnn UTSW 1 160118483 missense probably damaging 1.00
R8337:Tnn UTSW 1 160118483 missense probably damaging 1.00
R8338:Tnn UTSW 1 160118483 missense probably damaging 1.00
R8427:Tnn UTSW 1 160130686 missense probably damaging 0.99
R8433:Tnn UTSW 1 160097220 missense possibly damaging 0.81
R8479:Tnn UTSW 1 160122827 missense probably benign 0.06
R8505:Tnn UTSW 1 160146023 missense probably damaging 0.98
R8554:Tnn UTSW 1 160110416 missense probably damaging 1.00
R8717:Tnn UTSW 1 160116276 missense possibly damaging 0.51
R8850:Tnn UTSW 1 160110244 critical splice donor site probably null
X0019:Tnn UTSW 1 160086146 missense probably damaging 1.00
Z1176:Tnn UTSW 1 160146293 missense probably benign
Z1177:Tnn UTSW 1 160126527 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGAGAGTTACTGTCCCTGCAG -3'
(R):5'- AGCCTTAAGTGAATAGTAGGTGCTG -3'

Sequencing Primer
(F):5'- CTGCAGACAGCCTGTATCTGATG -3'
(R):5'- GGAGAATATTCATTTGGCCACCCAG -3'
Posted On2015-09-24