Incidental Mutation 'R4588:Scn2a'
ID342598
Institutional Source Beutler Lab
Gene Symbol Scn2a
Ensembl Gene ENSMUSG00000075318
Gene Namesodium channel, voltage-gated, type II, alpha
SynonymsA230052E19Rik, Scn2a1, Nav1.2
MMRRC Submission 042007-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4588 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location65620771-65767447 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 65713767 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 831 (I831L)
Ref Sequence ENSEMBL: ENSMUSP00000143882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028377] [ENSMUST00000100067] [ENSMUST00000200829] [ENSMUST00000202508]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028377
AA Change: I831L

PolyPhen 2 Score 0.756 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000028377
Gene: ENSMUSG00000075318
AA Change: I831L

DomainStartEndE-ValueType
Pfam:Ion_trans 128 436 2.2e-81 PFAM
low complexity region 450 471 N/A INTRINSIC
Pfam:Na_trans_cytopl 505 710 9.6e-83 PFAM
Pfam:Ion_trans 759 994 3.6e-57 PFAM
Pfam:Na_trans_assoc 998 1204 1.7e-63 PFAM
Pfam:Ion_trans 1208 1484 3.3e-66 PFAM
Pfam:Ion_trans 1531 1788 2.8e-57 PFAM
Pfam:PKD_channel 1627 1782 8.6e-7 PFAM
IQ 1905 1927 3.59e-3 SMART
low complexity region 1967 1975 N/A INTRINSIC
low complexity region 1981 2000 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000100067
AA Change: I831L

PolyPhen 2 Score 0.756 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000097645
Gene: ENSMUSG00000075318
AA Change: I831L

DomainStartEndE-ValueType
Pfam:Ion_trans 157 424 3.3e-75 PFAM
low complexity region 433 448 N/A INTRINSIC
low complexity region 450 471 N/A INTRINSIC
Pfam:DUF3451 488 711 2.6e-66 PFAM
Pfam:Ion_trans 794 983 1.1e-47 PFAM
Pfam:Na_trans_assoc 998 1219 3.5e-77 PFAM
Pfam:Ion_trans 1245 1473 4.4e-55 PFAM
PDB:1BYY|A 1475 1527 3e-31 PDB
Pfam:Ion_trans 1566 1776 2.4e-52 PFAM
Pfam:PKD_channel 1628 1783 3.6e-7 PFAM
IQ 1905 1927 3.59e-3 SMART
low complexity region 1967 1975 N/A INTRINSIC
low complexity region 1981 2000 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000200829
AA Change: I831L

PolyPhen 2 Score 0.756 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000143882
Gene: ENSMUSG00000075318
AA Change: I831L

DomainStartEndE-ValueType
Pfam:Ion_trans 128 436 1.2e-79 PFAM
low complexity region 450 471 N/A INTRINSIC
Pfam:Na_trans_cytopl 505 710 7.1e-80 PFAM
Pfam:Ion_trans 759 994 2.1e-55 PFAM
Pfam:Na_trans_assoc 998 1204 8e-61 PFAM
Pfam:Ion_trans 1208 1484 1.9e-64 PFAM
Pfam:Ion_trans 1531 1788 1.6e-55 PFAM
Pfam:PKD_channel 1627 1782 1.2e-4 PFAM
IQ 1905 1927 1.8e-5 SMART
low complexity region 1967 1975 N/A INTRINSIC
low complexity region 1981 2000 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202162
Predicted Effect probably benign
Transcript: ENSMUST00000202508
SMART Domains Protein: ENSMUSP00000143958
Gene: ENSMUSG00000075318

DomainStartEndE-ValueType
Pfam:Na_trans_assoc 1 106 1.9e-19 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with four repeat domains, each of which is composed of six membrane-spanning segments, and one or more regulatory beta subunits. Voltage-gated sodium channels are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family. In humans, variants of this gene are associated with seizure disorders and autism spectrum disorder. Mice homozygous for a knockout mutation die with severe hypoxia and extensive neuronal cell death, while gain of function mutations result in progressive seizure disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2016]
PHENOTYPE: Homozygotes for a targeted mutation exhibit excess neuronal apoptosis (especially in the brainstem), reduced neuronal sodium channel currents in vitro, and severe hypoxia resulting in neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 G T 10: 79,997,867 probably null Het
Abcb4 A T 5: 8,947,328 I936F probably benign Het
Adnp2 G T 18: 80,128,648 L849I probably benign Het
Atf7ip T C 6: 136,599,694 S1032P probably benign Het
Atr A C 9: 95,865,667 D334A probably benign Het
Atrip A T 9: 109,060,279 D20E probably damaging Het
Atxn7 T A 14: 14,096,268 C43* probably null Het
Cfap65 C A 1: 74,904,056 Q1603H possibly damaging Het
Cpne5 T C 17: 29,164,713 I327V probably benign Het
Ctsa T C 2: 164,834,150 S41P possibly damaging Het
Cyp4x1 A T 4: 115,108,797 L444Q probably damaging Het
Dchs1 C A 7: 105,756,041 M2431I probably benign Het
Ddi1 T A 9: 6,266,003 H122L probably benign Het
Defa21 C T 8: 21,025,648 P21S probably damaging Het
Ect2 A G 3: 27,147,000 V77A probably damaging Het
Ermap C A 4: 119,188,248 probably benign Het
Fancm G A 12: 65,118,441 probably null Het
Gcnt3 T A 9: 70,034,230 D352V probably damaging Het
Gys2 A G 6: 142,449,455 M428T possibly damaging Het
Igtp T A 11: 58,206,682 N226K probably damaging Het
Itpr2 T A 6: 146,241,196 H1675L probably benign Het
Lipo4 G A 19: 33,499,247 P367L possibly damaging Het
Lzts3 T C 2: 130,634,766 *587W probably null Het
Mast3 T A 8: 70,780,607 K300* probably null Het
Mepce G A 5: 137,785,272 T264I possibly damaging Het
Mif4gd A T 11: 115,609,546 I62N probably damaging Het
Olfr307 C T 7: 86,335,644 V251I probably benign Het
Olfr869 T A 9: 20,138,087 *324K probably null Het
Palm3 A G 8: 84,029,386 K509R probably benign Het
Pde11a T C 2: 76,029,303 T821A probably damaging Het
Pik3r5 A G 11: 68,493,261 probably benign Het
Pkhd1 T C 1: 20,200,868 T3154A probably benign Het
Ptprs A G 17: 56,425,534 Y438H probably damaging Het
Rdh8 T A 9: 20,822,729 D70E probably benign Het
Selenoo A G 15: 89,096,718 H420R probably benign Het
Slc22a16 T C 10: 40,570,681 probably benign Het
Slc5a1 A G 5: 33,145,288 T208A probably benign Het
Sparc T C 11: 55,405,236 M121V probably benign Het
Sstr1 G T 12: 58,213,631 A347S probably benign Het
Stab1 C A 14: 31,157,445 V693F probably benign Het
Tnn A G 1: 160,145,111 V307A probably benign Het
Trmt1 A G 8: 84,690,753 probably benign Het
Ttc3 T C 16: 94,442,901 S1255P probably benign Het
Ube2ql1 A C 13: 69,739,157 S62A unknown Het
Vmn2r84 T A 10: 130,385,940 M804L probably damaging Het
Vps13a T C 19: 16,640,039 T3002A probably damaging Het
Vps50 A G 6: 3,562,306 E467G probably damaging Het
Other mutations in Scn2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Scn2a APN 2 65764440 missense probably benign
IGL00159:Scn2a APN 2 65743090 missense probably damaging 1.00
IGL00418:Scn2a APN 2 65764522 missense probably benign 0.43
IGL00753:Scn2a APN 2 65683863 missense possibly damaging 0.66
IGL00770:Scn2a APN 2 65735853 missense probably damaging 1.00
IGL00774:Scn2a APN 2 65735853 missense probably damaging 1.00
IGL00847:Scn2a APN 2 65670734 missense probably damaging 1.00
IGL01155:Scn2a APN 2 65717748 missense probably damaging 1.00
IGL01329:Scn2a APN 2 65717508 missense probably benign 0.05
IGL01537:Scn2a APN 2 65715875 missense probably benign 0.00
IGL01672:Scn2a APN 2 65751934 missense probably damaging 1.00
IGL01958:Scn2a APN 2 65701829 missense probably damaging 1.00
IGL02028:Scn2a APN 2 65763658 missense probably damaging 0.96
IGL02142:Scn2a APN 2 65715838 missense probably damaging 1.00
IGL02160:Scn2a APN 2 65730116 missense probably damaging 1.00
IGL02183:Scn2a APN 2 65671603 missense probably benign 0.20
IGL02341:Scn2a APN 2 65688377 missense probably damaging 1.00
IGL02504:Scn2a APN 2 65683884 missense probably benign 0.02
IGL02530:Scn2a APN 2 65730178 missense probably damaging 0.99
IGL02621:Scn2a APN 2 65748879 splice site probably benign
IGL02652:Scn2a APN 2 65702038 missense possibly damaging 0.82
IGL02966:Scn2a APN 2 65701844 missense possibly damaging 0.93
IGL03188:Scn2a APN 2 65671653 missense probably damaging 0.99
IGL03329:Scn2a APN 2 65764629 missense probably benign
IGL03336:Scn2a APN 2 65688744 missense probably damaging 1.00
IGL03391:Scn2a APN 2 65764213 missense probably damaging 1.00
PIT4280001:Scn2a UTSW 2 65715730 missense probably damaging 1.00
PIT4362001:Scn2a UTSW 2 65683838 missense probably benign 0.09
PIT4403001:Scn2a UTSW 2 65711908 missense probably damaging 1.00
PIT4520001:Scn2a UTSW 2 65688419 missense probably damaging 1.00
R0021:Scn2a UTSW 2 65670515 missense possibly damaging 0.51
R0141:Scn2a UTSW 2 65711816 missense probably benign 0.01
R0240:Scn2a UTSW 2 65735774 missense probably benign 0.32
R0240:Scn2a UTSW 2 65735774 missense probably benign 0.32
R0335:Scn2a UTSW 2 65682091 missense probably damaging 1.00
R0508:Scn2a UTSW 2 65717842 missense probably damaging 0.99
R0558:Scn2a UTSW 2 65711925 missense probably benign 0.26
R0600:Scn2a UTSW 2 65701833 missense possibly damaging 0.90
R0667:Scn2a UTSW 2 65751996 missense possibly damaging 0.91
R1178:Scn2a UTSW 2 65686779 splice site probably benign
R1244:Scn2a UTSW 2 65763655 missense probably damaging 0.98
R1386:Scn2a UTSW 2 65688741 missense probably damaging 1.00
R1434:Scn2a UTSW 2 65701991 missense possibly damaging 0.79
R1440:Scn2a UTSW 2 65764594 missense probably benign
R1448:Scn2a UTSW 2 65683845 missense probably benign 0.17
R1460:Scn2a UTSW 2 65701843 missense probably damaging 0.96
R1553:Scn2a UTSW 2 65713836 nonsense probably null
R1642:Scn2a UTSW 2 65683697 missense probably damaging 1.00
R1803:Scn2a UTSW 2 65670767 splice site probably null
R1981:Scn2a UTSW 2 65690170 missense probably damaging 1.00
R2002:Scn2a UTSW 2 65682083 missense probably null 1.00
R2068:Scn2a UTSW 2 65752073 missense probably benign 0.14
R2125:Scn2a UTSW 2 65752079 nonsense probably null
R2126:Scn2a UTSW 2 65752079 nonsense probably null
R2876:Scn2a UTSW 2 65715897 missense possibly damaging 0.64
R2878:Scn2a UTSW 2 65688371 missense probably damaging 1.00
R3113:Scn2a UTSW 2 65748785 missense possibly damaging 0.86
R3749:Scn2a UTSW 2 65713771 missense probably damaging 1.00
R3750:Scn2a UTSW 2 65713771 missense probably damaging 1.00
R3765:Scn2a UTSW 2 65682710 missense possibly damaging 0.51
R3850:Scn2a UTSW 2 65682031 missense probably benign 0.14
R4585:Scn2a UTSW 2 65743051 splice site probably null
R4586:Scn2a UTSW 2 65743051 splice site probably null
R4622:Scn2a UTSW 2 65752027 missense probably benign 0.04
R5108:Scn2a UTSW 2 65688630 missense probably damaging 1.00
R5161:Scn2a UTSW 2 65764591 missense probably benign 0.00
R5235:Scn2a UTSW 2 65752011 missense probably damaging 1.00
R5464:Scn2a UTSW 2 65701756 missense probably damaging 1.00
R5586:Scn2a UTSW 2 65707295 nonsense probably null
R5630:Scn2a UTSW 2 65726365 missense probably damaging 1.00
R5715:Scn2a UTSW 2 65717584 missense probably benign 0.27
R5730:Scn2a UTSW 2 65682538 nonsense probably null
R5734:Scn2a UTSW 2 65717722 missense possibly damaging 0.49
R5779:Scn2a UTSW 2 65764483 missense probably benign 0.00
R6133:Scn2a UTSW 2 65743104 missense probably benign 0.35
R6547:Scn2a UTSW 2 65715897 missense probably benign 0.29
R6549:Scn2a UTSW 2 65764674 missense probably benign 0.05
R6818:Scn2a UTSW 2 65688669 nonsense probably null
R6999:Scn2a UTSW 2 65682109 missense probably benign
R7069:Scn2a UTSW 2 65764606 missense probably benign 0.00
R7073:Scn2a UTSW 2 65728443 missense probably benign 0.00
R7125:Scn2a UTSW 2 65763933 missense probably damaging 1.00
R7178:Scn2a UTSW 2 65748853 nonsense probably null
R7179:Scn2a UTSW 2 65701979 missense probably damaging 1.00
R7203:Scn2a UTSW 2 65748319 missense probably benign 0.01
R7227:Scn2a UTSW 2 65752023 missense probably damaging 0.98
R7269:Scn2a UTSW 2 65763769 missense probably damaging 1.00
R7358:Scn2a UTSW 2 65682506 nonsense probably null
R7388:Scn2a UTSW 2 65688654 missense probably damaging 1.00
R7491:Scn2a UTSW 2 65702008 missense probably damaging 0.99
R7619:Scn2a UTSW 2 65715903 missense probably damaging 1.00
R7695:Scn2a UTSW 2 65711907 missense probably damaging 0.99
R7735:Scn2a UTSW 2 65763669 missense probably benign 0.40
R7911:Scn2a UTSW 2 65682083 missense probably null 1.00
R8096:Scn2a UTSW 2 65764022 missense probably damaging 0.98
R8333:Scn2a UTSW 2 65683847 missense probably benign 0.01
R8416:Scn2a UTSW 2 65681001 missense probably benign 0.00
R8850:Scn2a UTSW 2 65688386 missense probably damaging 1.00
Z1176:Scn2a UTSW 2 65751868 missense possibly damaging 0.84
Z1177:Scn2a UTSW 2 65717735 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- GGACATCCATTGTTTGAACACAAAC -3'
(R):5'- AATCTGGCTTGATATGAGACTCCC -3'

Sequencing Primer
(F):5'- GTTTGAACACAAACCAACCTTTAAG -3'
(R):5'- TCCCACTTGATATTCAGAGAGAGAG -3'
Posted On2015-09-24