Incidental Mutation 'R4588:Pde11a'
ID342599
Institutional Source Beutler Lab
Gene Symbol Pde11a
Ensembl Gene ENSMUSG00000075270
Gene Namephosphodiesterase 11A
SynonymsA630086N24Rik, 6330414F14Rik
MMRRC Submission 042007-MU
Accession Numbers

Genbank: NM_001081033; MGI: 3036251

Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R4588 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location75989141-76338774 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 76029303 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 821 (T821A)
Ref Sequence ENSEMBL: ENSMUSP00000097572 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099992]
Predicted Effect probably damaging
Transcript: ENSMUST00000099992
AA Change: T821A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097572
Gene: ENSMUSG00000075270
AA Change: T821A

DomainStartEndE-ValueType
low complexity region 68 82 N/A INTRINSIC
low complexity region 149 164 N/A INTRINSIC
GAF 217 380 1.79e-30 SMART
GAF 402 568 2.34e-25 SMART
HDc 661 830 7.75e-6 SMART
Predicted Effect unknown
Transcript: ENSMUST00000144892
AA Change: T428A
SMART Domains Protein: ENSMUSP00000115662
Gene: ENSMUSG00000075270
AA Change: T428A

DomainStartEndE-ValueType
GAF 41 207 9.16e-19 SMART
HDc 269 438 2.04e-5 SMART
Meta Mutation Damage Score 0.2016 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The 3',5'-cyclic nucleotides cAMP and cGMP function as second messengers in a wide variety of signal transduction pathways. 3',5'-cyclic nucleotide phosphodiesterases (PDEs) catalyze the hydrolysis of cAMP and cGMP to the corresponding 5'-monophosphates and provide a mechanism to downregulate cAMP and cGMP signaling. This gene encodes a member of the PDE protein superfamily. Mutations in this gene are a cause of Cushing disease and adrenocortical hyperplasia. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele have enlarged lateral ventricles and exhibit abnormal behavior. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, knock-out(1) Gene trapped(1)

Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 G T 10: 79,997,867 probably null Het
Abcb4 A T 5: 8,947,328 I936F probably benign Het
Adnp2 G T 18: 80,128,648 L849I probably benign Het
Atf7ip T C 6: 136,599,694 S1032P probably benign Het
Atr A C 9: 95,865,667 D334A probably benign Het
Atrip A T 9: 109,060,279 D20E probably damaging Het
Atxn7 T A 14: 14,096,268 C43* probably null Het
Cfap65 C A 1: 74,904,056 Q1603H possibly damaging Het
Cpne5 T C 17: 29,164,713 I327V probably benign Het
Ctsa T C 2: 164,834,150 S41P possibly damaging Het
Cyp4x1 A T 4: 115,108,797 L444Q probably damaging Het
Dchs1 C A 7: 105,756,041 M2431I probably benign Het
Ddi1 T A 9: 6,266,003 H122L probably benign Het
Defa21 C T 8: 21,025,648 P21S probably damaging Het
Ect2 A G 3: 27,147,000 V77A probably damaging Het
Ermap C A 4: 119,188,248 probably benign Het
Fancm G A 12: 65,118,441 probably null Het
Gcnt3 T A 9: 70,034,230 D352V probably damaging Het
Gys2 A G 6: 142,449,455 M428T possibly damaging Het
Igtp T A 11: 58,206,682 N226K probably damaging Het
Itpr2 T A 6: 146,241,196 H1675L probably benign Het
Lipo4 G A 19: 33,499,247 P367L possibly damaging Het
Lzts3 T C 2: 130,634,766 *587W probably null Het
Mast3 T A 8: 70,780,607 K300* probably null Het
Mepce G A 5: 137,785,272 T264I possibly damaging Het
Mif4gd A T 11: 115,609,546 I62N probably damaging Het
Olfr307 C T 7: 86,335,644 V251I probably benign Het
Olfr869 T A 9: 20,138,087 *324K probably null Het
Palm3 A G 8: 84,029,386 K509R probably benign Het
Pik3r5 A G 11: 68,493,261 probably benign Het
Pkhd1 T C 1: 20,200,868 T3154A probably benign Het
Ptprs A G 17: 56,425,534 Y438H probably damaging Het
Rdh8 T A 9: 20,822,729 D70E probably benign Het
Scn2a A T 2: 65,713,767 I831L possibly damaging Het
Selenoo A G 15: 89,096,718 H420R probably benign Het
Slc22a16 T C 10: 40,570,681 probably benign Het
Slc5a1 A G 5: 33,145,288 T208A probably benign Het
Sparc T C 11: 55,405,236 M121V probably benign Het
Sstr1 G T 12: 58,213,631 A347S probably benign Het
Stab1 C A 14: 31,157,445 V693F probably benign Het
Tnn A G 1: 160,145,111 V307A probably benign Het
Trmt1 A G 8: 84,690,753 probably benign Het
Ttc3 T C 16: 94,442,901 S1255P probably benign Het
Ube2ql1 A C 13: 69,739,157 S62A unknown Het
Vmn2r84 T A 10: 130,385,940 M804L probably damaging Het
Vps13a T C 19: 16,640,039 T3002A probably damaging Het
Vps50 A G 6: 3,562,306 E467G probably damaging Het
Other mutations in Pde11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00839:Pde11a APN 2 76215385 missense probably damaging 1.00
IGL01528:Pde11a APN 2 76194956 splice site probably benign
IGL02117:Pde11a APN 2 75991262 missense probably damaging 1.00
IGL02428:Pde11a APN 2 76046845 missense possibly damaging 0.68
IGL02455:Pde11a APN 2 76158393 missense possibly damaging 0.58
IGL02731:Pde11a APN 2 75991239 missense probably benign 0.00
IGL03068:Pde11a APN 2 76017864 missense probably damaging 1.00
IGL03081:Pde11a APN 2 76075930 splice site probably benign
D4186:Pde11a UTSW 2 76291290 missense probably damaging 1.00
R0323:Pde11a UTSW 2 76046774 splice site probably null
R0433:Pde11a UTSW 2 76337706 missense possibly damaging 0.47
R1226:Pde11a UTSW 2 76158354 missense probably benign 0.10
R1542:Pde11a UTSW 2 76046855 missense probably benign 0.25
R1941:Pde11a UTSW 2 76291250 missense probably benign 0.10
R2107:Pde11a UTSW 2 76337922 missense probably damaging 1.00
R2394:Pde11a UTSW 2 76059061 missense probably benign 0.00
R3689:Pde11a UTSW 2 76291166 missense probably damaging 1.00
R3690:Pde11a UTSW 2 76291166 missense probably damaging 1.00
R3945:Pde11a UTSW 2 76075931 splice site probably benign
R4073:Pde11a UTSW 2 76337898 missense probably damaging 1.00
R4074:Pde11a UTSW 2 76337898 missense probably damaging 1.00
R4602:Pde11a UTSW 2 76158333 missense probably benign 0.05
R4604:Pde11a UTSW 2 76337793 missense possibly damaging 0.89
R4609:Pde11a UTSW 2 76291241 missense possibly damaging 0.94
R4610:Pde11a UTSW 2 76158333 missense probably benign 0.05
R5017:Pde11a UTSW 2 76136367 missense probably benign 0.05
R5519:Pde11a UTSW 2 76075955 missense probably damaging 1.00
R5930:Pde11a UTSW 2 76139831 splice site probably null
R6000:Pde11a UTSW 2 76017860 missense probably damaging 0.98
R6018:Pde11a UTSW 2 76017850 missense probably benign 0.00
R6913:Pde11a UTSW 2 76337740 missense probably damaging 1.00
R7117:Pde11a UTSW 2 76076004 missense probably damaging 1.00
R7258:Pde11a UTSW 2 76139906 missense possibly damaging 0.91
R7267:Pde11a UTSW 2 76337845 missense probably damaging 1.00
R7409:Pde11a UTSW 2 76005984 missense
R7451:Pde11a UTSW 2 76022773 missense possibly damaging 0.89
R7452:Pde11a UTSW 2 76136414 missense probably damaging 1.00
R7598:Pde11a UTSW 2 76136423 missense probably damaging 1.00
R7671:Pde11a UTSW 2 76215353 missense possibly damaging 0.81
R7886:Pde11a UTSW 2 76291203 missense probably benign
R8045:Pde11a UTSW 2 76022728 missense probably damaging 0.99
R8137:Pde11a UTSW 2 76211039 missense possibly damaging 0.91
R8420:Pde11a UTSW 2 76059010 missense probably damaging 1.00
R8716:Pde11a UTSW 2 76017894 missense probably damaging 0.97
R8730:Pde11a UTSW 2 76058990 missense probably damaging 1.00
R8816:Pde11a UTSW 2 76291233 missense probably benign 0.00
R8869:Pde11a UTSW 2 76211090 missense probably benign 0.02
Z1176:Pde11a UTSW 2 76194905 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCCAGAAATAGCACTGTTGAGG -3'
(R):5'- GGCAGTGTCCACTTCATGATG -3'

Sequencing Primer
(F):5'- CCTGGAGAGAAAGACTGT -3'
(R):5'- TGTCCACTTCATGATGGAGAAGC -3'
Posted On2015-09-24