Incidental Mutation 'R4588:Lzts3'
ID342600
Institutional Source Beutler Lab
Gene Symbol Lzts3
Ensembl Gene ENSMUSG00000037703
Gene Nameleucine zipper, putative tumor suppressor family member 3
SynonymsProsapip1
MMRRC Submission 042007-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock #R4588 (G1)
Quality Score178
Status Validated
Chromosome2
Chromosomal Location130632839-130642803 bp(-) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) T to C at 130634766 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Tryptophan at position 587 (*587W)
Ref Sequence ENSEMBL: ENSMUSP00000105889 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028761] [ENSMUST00000045761] [ENSMUST00000089561] [ENSMUST00000110260] [ENSMUST00000110262] [ENSMUST00000140581]
Predicted Effect probably benign
Transcript: ENSMUST00000028761
SMART Domains Protein: ENSMUSP00000028761
Gene: ENSMUSG00000027300

DomainStartEndE-ValueType
Ubox 262 331 4.47e-15 SMART
low complexity region 371 395 N/A INTRINSIC
RING 481 525 3.14e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000045761
AA Change: *701W
SMART Domains Protein: ENSMUSP00000037109
Gene: ENSMUSG00000037703
AA Change: *701W

DomainStartEndE-ValueType
low complexity region 86 107 N/A INTRINSIC
low complexity region 147 158 N/A INTRINSIC
low complexity region 240 250 N/A INTRINSIC
low complexity region 253 265 N/A INTRINSIC
low complexity region 285 297 N/A INTRINSIC
low complexity region 301 333 N/A INTRINSIC
low complexity region 337 346 N/A INTRINSIC
low complexity region 349 361 N/A INTRINSIC
low complexity region 402 436 N/A INTRINSIC
Pfam:Fez1 465 665 1.4e-62 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000089561
AA Change: *701W
SMART Domains Protein: ENSMUSP00000086990
Gene: ENSMUSG00000037703
AA Change: *701W

DomainStartEndE-ValueType
low complexity region 86 107 N/A INTRINSIC
low complexity region 147 158 N/A INTRINSIC
low complexity region 240 250 N/A INTRINSIC
low complexity region 253 265 N/A INTRINSIC
low complexity region 285 297 N/A INTRINSIC
low complexity region 301 333 N/A INTRINSIC
low complexity region 337 346 N/A INTRINSIC
low complexity region 349 361 N/A INTRINSIC
low complexity region 402 436 N/A INTRINSIC
Pfam:Fez1 465 666 2.1e-74 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000110260
AA Change: *587W
SMART Domains Protein: ENSMUSP00000105889
Gene: ENSMUSG00000037703
AA Change: *587W

DomainStartEndE-ValueType
low complexity region 126 136 N/A INTRINSIC
low complexity region 139 151 N/A INTRINSIC
low complexity region 171 183 N/A INTRINSIC
low complexity region 187 219 N/A INTRINSIC
low complexity region 223 232 N/A INTRINSIC
low complexity region 235 247 N/A INTRINSIC
low complexity region 288 322 N/A INTRINSIC
Pfam:Fez1 351 552 1.5e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110262
SMART Domains Protein: ENSMUSP00000105891
Gene: ENSMUSG00000079043

DomainStartEndE-ValueType
Pfam:FAST_1 475 544 6e-22 PFAM
Pfam:FAST_2 555 646 7.2e-25 PFAM
RAP 742 801 6.92e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140581
SMART Domains Protein: ENSMUSP00000114878
Gene: ENSMUSG00000027300

DomainStartEndE-ValueType
Pfam:FAST_1 474 546 2.6e-27 PFAM
Pfam:FAST_2 553 598 2.1e-10 PFAM
Meta Mutation Damage Score 0.9377 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 98% (51/52)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 G T 10: 79,997,867 probably null Het
Abcb4 A T 5: 8,947,328 I936F probably benign Het
Adnp2 G T 18: 80,128,648 L849I probably benign Het
Atf7ip T C 6: 136,599,694 S1032P probably benign Het
Atr A C 9: 95,865,667 D334A probably benign Het
Atrip A T 9: 109,060,279 D20E probably damaging Het
Atxn7 T A 14: 14,096,268 C43* probably null Het
Cfap65 C A 1: 74,904,056 Q1603H possibly damaging Het
Cpne5 T C 17: 29,164,713 I327V probably benign Het
Ctsa T C 2: 164,834,150 S41P possibly damaging Het
Cyp4x1 A T 4: 115,108,797 L444Q probably damaging Het
Dchs1 C A 7: 105,756,041 M2431I probably benign Het
Ddi1 T A 9: 6,266,003 H122L probably benign Het
Defa21 C T 8: 21,025,648 P21S probably damaging Het
Ect2 A G 3: 27,147,000 V77A probably damaging Het
Ermap C A 4: 119,188,248 probably benign Het
Fancm G A 12: 65,118,441 probably null Het
Gcnt3 T A 9: 70,034,230 D352V probably damaging Het
Gys2 A G 6: 142,449,455 M428T possibly damaging Het
Igtp T A 11: 58,206,682 N226K probably damaging Het
Itpr2 T A 6: 146,241,196 H1675L probably benign Het
Lipo4 G A 19: 33,499,247 P367L possibly damaging Het
Mast3 T A 8: 70,780,607 K300* probably null Het
Mepce G A 5: 137,785,272 T264I possibly damaging Het
Mif4gd A T 11: 115,609,546 I62N probably damaging Het
Olfr307 C T 7: 86,335,644 V251I probably benign Het
Olfr869 T A 9: 20,138,087 *324K probably null Het
Palm3 A G 8: 84,029,386 K509R probably benign Het
Pde11a T C 2: 76,029,303 T821A probably damaging Het
Pik3r5 A G 11: 68,493,261 probably benign Het
Pkhd1 T C 1: 20,200,868 T3154A probably benign Het
Ptprs A G 17: 56,425,534 Y438H probably damaging Het
Rdh8 T A 9: 20,822,729 D70E probably benign Het
Scn2a A T 2: 65,713,767 I831L possibly damaging Het
Selenoo A G 15: 89,096,718 H420R probably benign Het
Slc22a16 T C 10: 40,570,681 probably benign Het
Slc5a1 A G 5: 33,145,288 T208A probably benign Het
Sparc T C 11: 55,405,236 M121V probably benign Het
Sstr1 G T 12: 58,213,631 A347S probably benign Het
Stab1 C A 14: 31,157,445 V693F probably benign Het
Tnn A G 1: 160,145,111 V307A probably benign Het
Trmt1 A G 8: 84,690,753 probably benign Het
Ttc3 T C 16: 94,442,901 S1255P probably benign Het
Ube2ql1 A C 13: 69,739,157 S62A unknown Het
Vmn2r84 T A 10: 130,385,940 M804L probably damaging Het
Vps13a T C 19: 16,640,039 T3002A probably damaging Het
Vps50 A G 6: 3,562,306 E467G probably damaging Het
Other mutations in Lzts3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01072:Lzts3 APN 2 130635445 missense probably damaging 0.99
IGL01541:Lzts3 APN 2 130636206 missense probably damaging 0.99
IGL01649:Lzts3 APN 2 130635431 missense probably damaging 0.98
IGL02746:Lzts3 APN 2 130636341 missense probably damaging 0.98
IGL02927:Lzts3 APN 2 130637957 utr 5 prime probably benign
R0069:Lzts3 UTSW 2 130636540 missense probably benign 0.16
R0069:Lzts3 UTSW 2 130636540 missense probably benign 0.16
R0173:Lzts3 UTSW 2 130634768 makesense probably null
R1381:Lzts3 UTSW 2 130635299 missense probably damaging 0.99
R4127:Lzts3 UTSW 2 130635365 missense probably damaging 0.99
R4301:Lzts3 UTSW 2 130636438 missense probably damaging 0.99
R5289:Lzts3 UTSW 2 130636101 missense probably benign 0.18
R5878:Lzts3 UTSW 2 130636539 missense probably damaging 1.00
R5964:Lzts3 UTSW 2 130636288 missense probably damaging 0.99
R6193:Lzts3 UTSW 2 130637386 missense probably damaging 0.97
R7692:Lzts3 UTSW 2 130635386 missense probably benign 0.27
R8195:Lzts3 UTSW 2 130635185 missense probably benign 0.01
R8273:Lzts3 UTSW 2 130634881 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- TATCTCCAACACGAGGCTTCC -3'
(R):5'- CTCCAGCTGAGTTATGTGGAG -3'

Sequencing Primer
(F):5'- GGTCACCCACAAAGGCAGTG -3'
(R):5'- TTATGTGGAGATGTATCAGCGCAAC -3'
Posted On2015-09-24