Incidental Mutation 'R4588:Ctsa'
ID342601
Institutional Source Beutler Lab
Gene Symbol Ctsa
Ensembl Gene ENSMUSG00000017760
Gene Namecathepsin A
SynonymsPpgb, PPCA
MMRRC Submission 042007-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.300) question?
Stock #R4588 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location164832873-164841032 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 164834150 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 41 (S41P)
Ref Sequence ENSEMBL: ENSMUSP00000115514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017904] [ENSMUST00000042775] [ENSMUST00000103092] [ENSMUST00000103093] [ENSMUST00000127650] [ENSMUST00000143780] [ENSMUST00000152721] [ENSMUST00000151493]
Predicted Effect probably benign
Transcript: ENSMUST00000017904
AA Change: S59P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000017904
Gene: ENSMUSG00000017760
AA Change: S59P

DomainStartEndE-ValueType
signal peptide 1 41 N/A INTRINSIC
Pfam:Peptidase_S10 52 489 2.5e-140 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000042775
SMART Domains Protein: ENSMUSP00000041806
Gene: ENSMUSG00000039873

DomainStartEndE-ValueType
Pfam:Neuralized 25 90 1.1e-27 PFAM
SOCS_box 248 285 3.77e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103092
AA Change: S59P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099381
Gene: ENSMUSG00000017760
AA Change: S59P

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Peptidase_S10 34 471 1.7e-139 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103093
AA Change: S41P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099382
Gene: ENSMUSG00000017760
AA Change: S41P

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Peptidase_S10 34 471 1.7e-139 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000127650
AA Change: S41P

PolyPhen 2 Score 0.624 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000115514
Gene: ENSMUSG00000017760
AA Change: S41P

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Peptidase_S10 34 215 9.4e-81 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128596
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130959
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133077
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133502
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140213
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143293
Predicted Effect probably benign
Transcript: ENSMUST00000143780
AA Change: S53P

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000123413
Gene: ENSMUSG00000017760
AA Change: S53P

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Peptidase_S10 34 144 2.1e-52 PFAM
Pfam:Peptidase_S10 141 208 1.1e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144580
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155061
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146525
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147883
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152721
SMART Domains Protein: ENSMUSP00000119814
Gene: ENSMUSG00000017760

DomainStartEndE-ValueType
Pfam:Peptidase_S10 45 227 1.7e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151493
Meta Mutation Damage Score 0.0652 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: This gene encodes a glycoprotein with deamidase, esterase and carboxypeptidase activities. The encoded protein associates with and provides a protective function to the lysosomal enzymes beta-galactosidase and neuraminidase. Deficiency of the related gene in humans results in galactosialidosis. The proprotein is processed into two shorter chains. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2013]
PHENOTYPE: Homozygous mutants show aberrant lysosomal storage, with vacuolization in specific cells of most tissues. An abormally flat face and reduced body size are apparent at birth, and health progressively deteriorates, with accompanying generalized edema, ataxia and tremors. Death occurs at ~12 months. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 G T 10: 79,997,867 probably null Het
Abcb4 A T 5: 8,947,328 I936F probably benign Het
Adnp2 G T 18: 80,128,648 L849I probably benign Het
Atf7ip T C 6: 136,599,694 S1032P probably benign Het
Atr A C 9: 95,865,667 D334A probably benign Het
Atrip A T 9: 109,060,279 D20E probably damaging Het
Atxn7 T A 14: 14,096,268 C43* probably null Het
Cfap65 C A 1: 74,904,056 Q1603H possibly damaging Het
Cpne5 T C 17: 29,164,713 I327V probably benign Het
Cyp4x1 A T 4: 115,108,797 L444Q probably damaging Het
Dchs1 C A 7: 105,756,041 M2431I probably benign Het
Ddi1 T A 9: 6,266,003 H122L probably benign Het
Defa21 C T 8: 21,025,648 P21S probably damaging Het
Ect2 A G 3: 27,147,000 V77A probably damaging Het
Ermap C A 4: 119,188,248 probably benign Het
Fancm G A 12: 65,118,441 probably null Het
Gcnt3 T A 9: 70,034,230 D352V probably damaging Het
Gys2 A G 6: 142,449,455 M428T possibly damaging Het
Igtp T A 11: 58,206,682 N226K probably damaging Het
Itpr2 T A 6: 146,241,196 H1675L probably benign Het
Lipo4 G A 19: 33,499,247 P367L possibly damaging Het
Lzts3 T C 2: 130,634,766 *587W probably null Het
Mast3 T A 8: 70,780,607 K300* probably null Het
Mepce G A 5: 137,785,272 T264I possibly damaging Het
Mif4gd A T 11: 115,609,546 I62N probably damaging Het
Olfr307 C T 7: 86,335,644 V251I probably benign Het
Olfr869 T A 9: 20,138,087 *324K probably null Het
Palm3 A G 8: 84,029,386 K509R probably benign Het
Pde11a T C 2: 76,029,303 T821A probably damaging Het
Pik3r5 A G 11: 68,493,261 probably benign Het
Pkhd1 T C 1: 20,200,868 T3154A probably benign Het
Ptprs A G 17: 56,425,534 Y438H probably damaging Het
Rdh8 T A 9: 20,822,729 D70E probably benign Het
Scn2a A T 2: 65,713,767 I831L possibly damaging Het
Selenoo A G 15: 89,096,718 H420R probably benign Het
Slc22a16 T C 10: 40,570,681 probably benign Het
Slc5a1 A G 5: 33,145,288 T208A probably benign Het
Sparc T C 11: 55,405,236 M121V probably benign Het
Sstr1 G T 12: 58,213,631 A347S probably benign Het
Stab1 C A 14: 31,157,445 V693F probably benign Het
Tnn A G 1: 160,145,111 V307A probably benign Het
Trmt1 A G 8: 84,690,753 probably benign Het
Ttc3 T C 16: 94,442,901 S1255P probably benign Het
Ube2ql1 A C 13: 69,739,157 S62A unknown Het
Vmn2r84 T A 10: 130,385,940 M804L probably damaging Het
Vps13a T C 19: 16,640,039 T3002A probably damaging Het
Vps50 A G 6: 3,562,306 E467G probably damaging Het
Other mutations in Ctsa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01778:Ctsa APN 2 164834310 unclassified probably benign
IGL02489:Ctsa APN 2 164838645 missense probably damaging 0.96
IGL02522:Ctsa APN 2 164839141 unclassified probably benign
IGL03008:Ctsa APN 2 164837448 missense probably damaging 1.00
R2058:Ctsa UTSW 2 164834902 missense probably null 0.00
R2402:Ctsa UTSW 2 164834893 missense probably benign 0.36
R3123:Ctsa UTSW 2 164835232 splice site probably null
R4270:Ctsa UTSW 2 164835302 missense probably benign 0.00
R5236:Ctsa UTSW 2 164838911 missense probably damaging 1.00
R5331:Ctsa UTSW 2 164834309 unclassified probably benign
R6258:Ctsa UTSW 2 164834361 missense probably damaging 1.00
R6260:Ctsa UTSW 2 164834361 missense probably damaging 1.00
R6853:Ctsa UTSW 2 164837364 missense probably benign 0.00
R7654:Ctsa UTSW 2 164838933 missense probably benign 0.38
R7822:Ctsa UTSW 2 164839232 makesense probably null
Predicted Primers PCR Primer
(F):5'- GTACGGAGATGCCCAAACTG -3'
(R):5'- ACTCCACAAACCTGGGAAGG -3'

Sequencing Primer
(F):5'- GAACTGCTGCACCGAAGC -3'
(R):5'- CTCCACAAACCTGGGAAGGATAGG -3'
Posted On2015-09-24