Incidental Mutation 'R4588:Mepce'
ID342607
Institutional Source Beutler Lab
Gene Symbol Mepce
Ensembl Gene ENSMUSG00000029726
Gene Namemethylphosphate capping enzyme
SynonymsBcdin3, D5Wsu46e
MMRRC Submission 042007-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4588 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location137781906-137787655 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 137785272 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 264 (T264I)
Ref Sequence ENSEMBL: ENSMUSP00000031740 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031740] [ENSMUST00000035852] [ENSMUST00000196022]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031740
AA Change: T264I

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000031740
Gene: ENSMUSG00000029726
AA Change: T264I

DomainStartEndE-ValueType
low complexity region 14 19 N/A INTRINSIC
low complexity region 49 74 N/A INTRINSIC
low complexity region 115 121 N/A INTRINSIC
low complexity region 130 136 N/A INTRINSIC
low complexity region 234 254 N/A INTRINSIC
low complexity region 307 352 N/A INTRINSIC
low complexity region 355 376 N/A INTRINSIC
Pfam:Methyltransf_23 398 623 2.7e-14 PFAM
Pfam:PrmA 408 489 6.9e-6 PFAM
Pfam:Methyltransf_31 419 480 9.3e-9 PFAM
Pfam:Methyltransf_18 420 595 1.8e-13 PFAM
Pfam:Bin3 552 660 4.2e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000035852
SMART Domains Protein: ENSMUSP00000048730
Gene: ENSMUSG00000037108

DomainStartEndE-ValueType
Pfam:zf-CW 246 293 7.3e-18 PFAM
Pfam:PWWP 306 401 6.9e-22 PFAM
coiled coil region 440 462 N/A INTRINSIC
low complexity region 587 598 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132726
SMART Domains Protein: ENSMUSP00000118688
Gene: ENSMUSG00000029726

DomainStartEndE-ValueType
Pfam:Methyltransf_11 33 99 8e-6 PFAM
Pfam:Bin3 59 167 8.3e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140336
Predicted Effect probably benign
Transcript: ENSMUST00000196022
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196936
Meta Mutation Damage Score 0.0766 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 98% (51/52)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 G T 10: 79,997,867 probably null Het
Abcb4 A T 5: 8,947,328 I936F probably benign Het
Adnp2 G T 18: 80,128,648 L849I probably benign Het
Atf7ip T C 6: 136,599,694 S1032P probably benign Het
Atr A C 9: 95,865,667 D334A probably benign Het
Atrip A T 9: 109,060,279 D20E probably damaging Het
Atxn7 T A 14: 14,096,268 C43* probably null Het
Cfap65 C A 1: 74,904,056 Q1603H possibly damaging Het
Cpne5 T C 17: 29,164,713 I327V probably benign Het
Ctsa T C 2: 164,834,150 S41P possibly damaging Het
Cyp4x1 A T 4: 115,108,797 L444Q probably damaging Het
Dchs1 C A 7: 105,756,041 M2431I probably benign Het
Ddi1 T A 9: 6,266,003 H122L probably benign Het
Defa21 C T 8: 21,025,648 P21S probably damaging Het
Ect2 A G 3: 27,147,000 V77A probably damaging Het
Ermap C A 4: 119,188,248 probably benign Het
Fancm G A 12: 65,118,441 probably null Het
Gcnt3 T A 9: 70,034,230 D352V probably damaging Het
Gys2 A G 6: 142,449,455 M428T possibly damaging Het
Igtp T A 11: 58,206,682 N226K probably damaging Het
Itpr2 T A 6: 146,241,196 H1675L probably benign Het
Lipo4 G A 19: 33,499,247 P367L possibly damaging Het
Lzts3 T C 2: 130,634,766 *587W probably null Het
Mast3 T A 8: 70,780,607 K300* probably null Het
Mif4gd A T 11: 115,609,546 I62N probably damaging Het
Olfr307 C T 7: 86,335,644 V251I probably benign Het
Olfr869 T A 9: 20,138,087 *324K probably null Het
Palm3 A G 8: 84,029,386 K509R probably benign Het
Pde11a T C 2: 76,029,303 T821A probably damaging Het
Pik3r5 A G 11: 68,493,261 probably benign Het
Pkhd1 T C 1: 20,200,868 T3154A probably benign Het
Ptprs A G 17: 56,425,534 Y438H probably damaging Het
Rdh8 T A 9: 20,822,729 D70E probably benign Het
Scn2a A T 2: 65,713,767 I831L possibly damaging Het
Selenoo A G 15: 89,096,718 H420R probably benign Het
Slc22a16 T C 10: 40,570,681 probably benign Het
Slc5a1 A G 5: 33,145,288 T208A probably benign Het
Sparc T C 11: 55,405,236 M121V probably benign Het
Sstr1 G T 12: 58,213,631 A347S probably benign Het
Stab1 C A 14: 31,157,445 V693F probably benign Het
Tnn A G 1: 160,145,111 V307A probably benign Het
Trmt1 A G 8: 84,690,753 probably benign Het
Ttc3 T C 16: 94,442,901 S1255P probably benign Het
Ube2ql1 A C 13: 69,739,157 S62A unknown Het
Vmn2r84 T A 10: 130,385,940 M804L probably damaging Het
Vps13a T C 19: 16,640,039 T3002A probably damaging Het
Vps50 A G 6: 3,562,306 E467G probably damaging Het
Other mutations in Mepce
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02205:Mepce APN 5 137784495 missense probably benign 0.14
Baden-powell UTSW 5 137785436 missense possibly damaging 0.70
Rushmore UTSW 5 137783260 missense probably damaging 0.98
R0254:Mepce UTSW 5 137785436 missense possibly damaging 0.70
R0772:Mepce UTSW 5 137785312 intron probably benign
R1081:Mepce UTSW 5 137784696 missense probably damaging 1.00
R4671:Mepce UTSW 5 137786643 intron probably benign
R4879:Mepce UTSW 5 137785282 intron probably benign
R5315:Mepce UTSW 5 137782693 missense probably damaging 1.00
R5334:Mepce UTSW 5 137786627 missense probably benign 0.00
R5341:Mepce UTSW 5 137783260 missense probably damaging 0.98
R5905:Mepce UTSW 5 137784720 missense possibly damaging 0.78
R6339:Mepce UTSW 5 137785688 missense possibly damaging 0.72
R6348:Mepce UTSW 5 137785436 missense possibly damaging 0.70
R6630:Mepce UTSW 5 137784921 missense probably benign 0.01
R7056:Mepce UTSW 5 137782706 missense probably damaging 1.00
R8054:Mepce UTSW 5 137784742 nonsense probably null
R8152:Mepce UTSW 5 137784673 missense probably benign 0.03
R8390:Mepce UTSW 5 137785179 missense possibly damaging 0.96
R8883:Mepce UTSW 5 137786517 intron probably benign
Z1176:Mepce UTSW 5 137785842 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCTCTGACTTGCTGGAAG -3'
(R):5'- TGGAGATCCTCATCCCCAAAG -3'

Sequencing Primer
(F):5'- AAGTCCTGCGACGTTTGC -3'
(R):5'- GATCCTCATCCCCAAAGATATTACTG -3'
Posted On2015-09-24