Incidental Mutation 'R4588:Defa21'
ID342615
Institutional Source Beutler Lab
Gene Symbol Defa21
Ensembl Gene ENSMUSG00000074447
Gene Namedefensin, alpha, 21
SynonymsDefcr21, 2010016B13Rik
MMRRC Submission 042007-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R4588 (G1)
Quality Score196
Status Not validated
Chromosome8
Chromosomal Location21025545-21026516 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 21025648 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 21 (P21S)
Ref Sequence ENSEMBL: ENSMUSP00000076041 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076754]
Predicted Effect probably damaging
Transcript: ENSMUST00000076754
AA Change: P21S

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000076041
Gene: ENSMUSG00000074447
AA Change: P21S

DomainStartEndE-ValueType
Pfam:Defensin_propep 1 51 4.1e-24 PFAM
DEFSN 64 89 1.25e-2 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 98% (51/52)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 G T 10: 79,997,867 probably null Het
Abcb4 A T 5: 8,947,328 I936F probably benign Het
Adnp2 G T 18: 80,128,648 L849I probably benign Het
Atf7ip T C 6: 136,599,694 S1032P probably benign Het
Atr A C 9: 95,865,667 D334A probably benign Het
Atrip A T 9: 109,060,279 D20E probably damaging Het
Atxn7 T A 14: 14,096,268 C43* probably null Het
Cfap65 C A 1: 74,904,056 Q1603H possibly damaging Het
Cpne5 T C 17: 29,164,713 I327V probably benign Het
Ctsa T C 2: 164,834,150 S41P possibly damaging Het
Cyp4x1 A T 4: 115,108,797 L444Q probably damaging Het
Dchs1 C A 7: 105,756,041 M2431I probably benign Het
Ddi1 T A 9: 6,266,003 H122L probably benign Het
Ect2 A G 3: 27,147,000 V77A probably damaging Het
Ermap C A 4: 119,188,248 probably benign Het
Fancm G A 12: 65,118,441 probably null Het
Gcnt3 T A 9: 70,034,230 D352V probably damaging Het
Gys2 A G 6: 142,449,455 M428T possibly damaging Het
Igtp T A 11: 58,206,682 N226K probably damaging Het
Itpr2 T A 6: 146,241,196 H1675L probably benign Het
Lipo4 G A 19: 33,499,247 P367L possibly damaging Het
Lzts3 T C 2: 130,634,766 *587W probably null Het
Mast3 T A 8: 70,780,607 K300* probably null Het
Mepce G A 5: 137,785,272 T264I possibly damaging Het
Mif4gd A T 11: 115,609,546 I62N probably damaging Het
Olfr307 C T 7: 86,335,644 V251I probably benign Het
Olfr869 T A 9: 20,138,087 *324K probably null Het
Palm3 A G 8: 84,029,386 K509R probably benign Het
Pde11a T C 2: 76,029,303 T821A probably damaging Het
Pik3r5 A G 11: 68,493,261 probably benign Het
Pkhd1 T C 1: 20,200,868 T3154A probably benign Het
Ptprs A G 17: 56,425,534 Y438H probably damaging Het
Rdh8 T A 9: 20,822,729 D70E probably benign Het
Scn2a A T 2: 65,713,767 I831L possibly damaging Het
Selenoo A G 15: 89,096,718 H420R probably benign Het
Slc22a16 T C 10: 40,570,681 probably benign Het
Slc5a1 A G 5: 33,145,288 T208A probably benign Het
Sparc T C 11: 55,405,236 M121V probably benign Het
Sstr1 G T 12: 58,213,631 A347S probably benign Het
Stab1 C A 14: 31,157,445 V693F probably benign Het
Tnn A G 1: 160,145,111 V307A probably benign Het
Trmt1 A G 8: 84,690,753 probably benign Het
Ttc3 T C 16: 94,442,901 S1255P probably benign Het
Ube2ql1 A C 13: 69,739,157 S62A unknown Het
Vmn2r84 T A 10: 130,385,940 M804L probably damaging Het
Vps13a T C 19: 16,640,039 T3002A probably damaging Het
Vps50 A G 6: 3,562,306 E467G probably damaging Het
Other mutations in Defa21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03388:Defa21 APN 8 21025748 missense probably damaging 0.99
R0035:Defa21 UTSW 8 21025768 splice site probably null
R5029:Defa21 UTSW 8 21026365 missense probably damaging 0.98
R7107:Defa21 UTSW 8 21025708 missense probably damaging 0.99
Z1176:Defa21 UTSW 8 21025723 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- TTCCCATCAAAGAGTGCCTTC -3'
(R):5'- AATAGAGTTGCCTTAGGAGCCAC -3'

Sequencing Primer
(F):5'- CCATCAAAGAGTGCCTTCTCTAAGTG -3'
(R):5'- GAGTTGCCTTAGGAGCCACATTAC -3'
Posted On2015-09-24