Incidental Mutation 'R4588:Mast3'
ID342616
Institutional Source Beutler Lab
Gene Symbol Mast3
Ensembl Gene ENSMUSG00000031833
Gene Namemicrotubule associated serine/threonine kinase 3
Synonyms
MMRRC Submission 042007-MU
Accession Numbers

Ncbi RefSeq: NM_199308.2. MGI:2683541

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4588 (G1)
Quality Score174
Status Validated
Chromosome8
Chromosomal Location70778117-70805054 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 70780607 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 300 (K300*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034296] [ENSMUST00000166004] [ENSMUST00000211948]
Predicted Effect probably benign
Transcript: ENSMUST00000034296
SMART Domains Protein: ENSMUSP00000034296
Gene: ENSMUSG00000031834

DomainStartEndE-ValueType
SH3 7 79 4e-7 SMART
RhoGAP 122 286 2.36e-18 SMART
low complexity region 291 311 N/A INTRINSIC
SH2 322 405 4.51e-26 SMART
Pfam:PI3K_P85_iSH2 422 590 1.7e-64 PFAM
SH2 614 696 9.96e-28 SMART
low complexity region 713 718 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142370
Predicted Effect probably null
Transcript: ENSMUST00000166004
AA Change: K1065*
SMART Domains Protein: ENSMUSP00000128703
Gene: ENSMUSG00000031833
AA Change: K1065*

DomainStartEndE-ValueType
low complexity region 43 59 N/A INTRINSIC
Pfam:DUF1908 64 337 4.4e-128 PFAM
S_TKc 373 646 2.77e-99 SMART
S_TK_X 647 710 2.39e-1 SMART
low complexity region 820 833 N/A INTRINSIC
low complexity region 910 942 N/A INTRINSIC
PDZ 958 1038 3.8e-15 SMART
low complexity region 1053 1074 N/A INTRINSIC
low complexity region 1089 1121 N/A INTRINSIC
low complexity region 1124 1150 N/A INTRINSIC
low complexity region 1180 1204 N/A INTRINSIC
low complexity region 1231 1248 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191396
Predicted Effect probably null
Transcript: ENSMUST00000211948
AA Change: K1049*
Predicted Effect probably null
Transcript: ENSMUST00000212140
AA Change: K300*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212172
Meta Mutation Damage Score 0.642 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 98% (51/52)
Allele List at MGI

All alleles(2) : Targeted(1) Gene trapped(1)

Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 G T 10: 79,997,867 probably null Het
Abcb4 A T 5: 8,947,328 I936F probably benign Het
Adnp2 G T 18: 80,128,648 L849I probably benign Het
Atf7ip T C 6: 136,599,694 S1032P probably benign Het
Atr A C 9: 95,865,667 D334A probably benign Het
Atrip A T 9: 109,060,279 D20E probably damaging Het
Atxn7 T A 14: 14,096,268 C43* probably null Het
Cfap65 C A 1: 74,904,056 Q1603H possibly damaging Het
Cpne5 T C 17: 29,164,713 I327V probably benign Het
Ctsa T C 2: 164,834,150 S41P possibly damaging Het
Cyp4x1 A T 4: 115,108,797 L444Q probably damaging Het
Dchs1 C A 7: 105,756,041 M2431I probably benign Het
Ddi1 T A 9: 6,266,003 H122L probably benign Het
Defa21 C T 8: 21,025,648 P21S probably damaging Het
Ect2 A G 3: 27,147,000 V77A probably damaging Het
Ermap C A 4: 119,188,248 probably benign Het
Fancm G A 12: 65,118,441 probably null Het
Gcnt3 T A 9: 70,034,230 D352V probably damaging Het
Gys2 A G 6: 142,449,455 M428T possibly damaging Het
Igtp T A 11: 58,206,682 N226K probably damaging Het
Itpr2 T A 6: 146,241,196 H1675L probably benign Het
Lipo4 G A 19: 33,499,247 P367L possibly damaging Het
Lzts3 T C 2: 130,634,766 *587W probably null Het
Mepce G A 5: 137,785,272 T264I possibly damaging Het
Mif4gd A T 11: 115,609,546 I62N probably damaging Het
Olfr307 C T 7: 86,335,644 V251I probably benign Het
Olfr869 T A 9: 20,138,087 *324K probably null Het
Palm3 A G 8: 84,029,386 K509R probably benign Het
Pde11a T C 2: 76,029,303 T821A probably damaging Het
Pik3r5 A G 11: 68,493,261 probably benign Het
Pkhd1 T C 1: 20,200,868 T3154A probably benign Het
Ptprs A G 17: 56,425,534 Y438H probably damaging Het
Rdh8 T A 9: 20,822,729 D70E probably benign Het
Scn2a A T 2: 65,713,767 I831L possibly damaging Het
Selenoo A G 15: 89,096,718 H420R probably benign Het
Slc22a16 T C 10: 40,570,681 probably benign Het
Slc5a1 A G 5: 33,145,288 T208A probably benign Het
Sparc T C 11: 55,405,236 M121V probably benign Het
Sstr1 G T 12: 58,213,631 A347S probably benign Het
Stab1 C A 14: 31,157,445 V693F probably benign Het
Tnn A G 1: 160,145,111 V307A probably benign Het
Trmt1 A G 8: 84,690,753 probably benign Het
Ttc3 T C 16: 94,442,901 S1255P probably benign Het
Ube2ql1 A C 13: 69,739,157 S62A unknown Het
Vmn2r84 T A 10: 130,385,940 M804L probably damaging Het
Vps13a T C 19: 16,640,039 T3002A probably damaging Het
Vps50 A G 6: 3,562,306 E467G probably damaging Het
Other mutations in Mast3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Mast3 APN 8 70780683 splice site probably benign
IGL01411:Mast3 APN 8 70779583 missense possibly damaging 0.50
IGL01475:Mast3 APN 8 70779530 missense probably damaging 1.00
IGL01886:Mast3 APN 8 70782139 missense possibly damaging 0.94
IGL02104:Mast3 APN 8 70787906 missense possibly damaging 0.78
IGL02236:Mast3 APN 8 70789244 missense probably benign 0.36
IGL02437:Mast3 APN 8 70780558 missense possibly damaging 0.79
IGL02704:Mast3 APN 8 70786875 missense probably damaging 1.00
IGL03155:Mast3 APN 8 70789217 missense probably damaging 1.00
IGL03366:Mast3 APN 8 70781563 nonsense probably null
R0037:Mast3 UTSW 8 70783699 critical splice donor site probably null
R0280:Mast3 UTSW 8 70783795 missense probably damaging 1.00
R0280:Mast3 UTSW 8 70787920 missense possibly damaging 0.65
R0731:Mast3 UTSW 8 70781321 missense probably damaging 1.00
R1101:Mast3 UTSW 8 70786663 missense probably damaging 1.00
R1177:Mast3 UTSW 8 70780324 missense probably damaging 1.00
R1208:Mast3 UTSW 8 70788272 unclassified probably null
R1208:Mast3 UTSW 8 70788272 unclassified probably null
R1333:Mast3 UTSW 8 70781294 missense probably damaging 1.00
R1543:Mast3 UTSW 8 70792311 missense possibly damaging 0.93
R1544:Mast3 UTSW 8 70786172 missense probably damaging 1.00
R1738:Mast3 UTSW 8 70784556 missense probably benign 0.38
R1842:Mast3 UTSW 8 70780393 missense possibly damaging 0.91
R1936:Mast3 UTSW 8 70784800 missense probably damaging 1.00
R2015:Mast3 UTSW 8 70787363 missense probably benign 0.00
R2219:Mast3 UTSW 8 70780963 missense probably damaging 0.99
R2220:Mast3 UTSW 8 70780963 missense probably damaging 0.99
R3711:Mast3 UTSW 8 70779607 missense probably benign 0.13
R3919:Mast3 UTSW 8 70779422 missense probably benign 0.02
R4027:Mast3 UTSW 8 70787908 missense probably damaging 1.00
R4060:Mast3 UTSW 8 70781194 missense probably damaging 1.00
R4061:Mast3 UTSW 8 70781194 missense probably damaging 1.00
R4062:Mast3 UTSW 8 70781194 missense probably damaging 1.00
R4063:Mast3 UTSW 8 70781194 missense probably damaging 1.00
R4672:Mast3 UTSW 8 70784797 frame shift probably null
R4770:Mast3 UTSW 8 70786220 missense probably damaging 1.00
R4822:Mast3 UTSW 8 70780366 missense probably damaging 1.00
R4830:Mast3 UTSW 8 70788915 missense possibly damaging 0.87
R5196:Mast3 UTSW 8 70788245 missense probably damaging 1.00
R5333:Mast3 UTSW 8 70783501 missense probably benign 0.03
R5428:Mast3 UTSW 8 70784733 missense possibly damaging 0.95
R5656:Mast3 UTSW 8 70786221 missense probably damaging 1.00
R5920:Mast3 UTSW 8 70787933 missense probably benign 0.00
R6177:Mast3 UTSW 8 70790018 missense probably damaging 1.00
R6186:Mast3 UTSW 8 70785483 missense probably damaging 1.00
R6407:Mast3 UTSW 8 70782128 missense probably benign 0.02
R6614:Mast3 UTSW 8 70781966 missense possibly damaging 0.95
R6804:Mast3 UTSW 8 70786732 missense probably benign 0.29
R6873:Mast3 UTSW 8 70786592 nonsense probably null
R6930:Mast3 UTSW 8 70799471 nonsense probably null
R6948:Mast3 UTSW 8 70785482 missense probably damaging 1.00
R7084:Mast3 UTSW 8 70779473 missense probably benign 0.14
R7253:Mast3 UTSW 8 70789682 critical splice donor site probably null
R7316:Mast3 UTSW 8 70779788 missense probably damaging 1.00
R7357:Mast3 UTSW 8 70784859 missense probably damaging 1.00
R7405:Mast3 UTSW 8 70786171 missense probably damaging 1.00
R7429:Mast3 UTSW 8 70780303 missense probably damaging 1.00
R7430:Mast3 UTSW 8 70780303 missense probably damaging 1.00
R7521:Mast3 UTSW 8 70788768 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- GAGCACAGAAGATGGCTTTG -3'
(R):5'- TGACACCACGAGCCTTTTATGG -3'

Sequencing Primer
(F):5'- CACAGAAGATGGCTTTGAGATCCTC -3'
(R):5'- ATGGCTGCACCTCCTCTATC -3'
Posted On2015-09-24