Mutagenetix > Incidental Mutation

Incidental Mutation 'R4588:Mast3'

342616

Institutional Source

Beutler Lab

Gene Symbol

Mast3

Ensembl Gene

ENSMUSG00000031833

Gene Name

microtubule associated serine/threonine kinase 3

Synonyms

MMRRC Submission

042007-MU

Accession Numbers

Ncbi RefSeq: NM_199308.2. MGI:2683541

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4588 (G1)

Quality Score

174

Status

Validated

Chromosome

Chromosomal Location

70778117-70805054 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 70780607 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Stop codon at position 300 (K300*)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034296] [ENSMUST00000166004] [ENSMUST00000211948]

AlphaFold

Q3U214

Predicted Effect

probably benign
Transcript: ENSMUST00000034296

SMART Domains

Protein: ENSMUSP00000034296
Gene: ENSMUSG00000031834

Domain	Start	End	E-Value	Type
SH3	7	79	4e-7	SMART
RhoGAP	122	286	2.36e-18	SMART
low complexity region	291	311	N/A	INTRINSIC
SH2	322	405	4.51e-26	SMART
Pfam:PI3K_P85_iSH2	422	590	1.7e-64	PFAM
SH2	614	696	9.96e-28	SMART
low complexity region	713	718	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142370

Predicted Effect

probably null
Transcript: ENSMUST00000166004
AA Change: K1065*

SMART Domains

Protein: ENSMUSP00000128703
Gene: ENSMUSG00000031833
AA Change: K1065*

Domain	Start	End	E-Value	Type
low complexity region	43	59	N/A	INTRINSIC
Pfam:DUF1908	64	337	4.4e-128	PFAM
S_TKc	373	646	2.77e-99	SMART
S_TK_X	647	710	2.39e-1	SMART
low complexity region	820	833	N/A	INTRINSIC
low complexity region	910	942	N/A	INTRINSIC
PDZ	958	1038	3.8e-15	SMART
low complexity region	1053	1074	N/A	INTRINSIC
low complexity region	1089	1121	N/A	INTRINSIC
low complexity region	1124	1150	N/A	INTRINSIC
low complexity region	1180	1204	N/A	INTRINSIC
low complexity region	1231	1248	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000191396

Predicted Effect

probably null
Transcript: ENSMUST00000211948
AA Change: K1049*

Predicted Effect

probably null
Transcript: ENSMUST00000212140
AA Change: K300*

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212172

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.2%

Validation Efficiency

98% (51/52)

Allele List at MGI

All alleles(2) : Targeted(1) Gene trapped(1)

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca7	G	T	10: 79,997,867		probably null	Het
Abcb4	A	T	5: 8,947,328	I936F	probably benign	Het
Adnp2	G	T	18: 80,128,648	L849I	probably benign	Het
Atf7ip	T	C	6: 136,599,694	S1032P	probably benign	Het
Atr	A	C	9: 95,865,667	D334A	probably benign	Het
Atrip	A	T	9: 109,060,279	D20E	probably damaging	Het
Atxn7	T	A	14: 14,096,268	C43*	probably null	Het
Cfap65	C	A	1: 74,904,056	Q1603H	possibly damaging	Het
Cpne5	T	C	17: 29,164,713	I327V	probably benign	Het
Ctsa	T	C	2: 164,834,150	S41P	possibly damaging	Het
Cyp4x1	A	T	4: 115,108,797	L444Q	probably damaging	Het
Dchs1	C	A	7: 105,756,041	M2431I	probably benign	Het
Ddi1	T	A	9: 6,266,003	H122L	probably benign	Het
Defa21	C	T	8: 21,025,648	P21S	probably damaging	Het
Ect2	A	G	3: 27,147,000	V77A	probably damaging	Het
Ermap	C	A	4: 119,188,248		probably benign	Het
Fancm	G	A	12: 65,118,441		probably null	Het
Gcnt3	T	A	9: 70,034,230	D352V	probably damaging	Het
Gys2	A	G	6: 142,449,455	M428T	possibly damaging	Het
Igtp	T	A	11: 58,206,682	N226K	probably damaging	Het
Itpr2	T	A	6: 146,241,196	H1675L	probably benign	Het
Lipo4	G	A	19: 33,499,247	P367L	possibly damaging	Het
Lzts3	T	C	2: 130,634,766	*587W	probably null	Het
Mepce	G	A	5: 137,785,272	T264I	possibly damaging	Het
Mif4gd	A	T	11: 115,609,546	I62N	probably damaging	Het
Olfr307	C	T	7: 86,335,644	V251I	probably benign	Het
Olfr869	T	A	9: 20,138,087	*324K	probably null	Het
Palm3	A	G	8: 84,029,386	K509R	probably benign	Het
Pde11a	T	C	2: 76,029,303	T821A	probably damaging	Het
Pik3r5	A	G	11: 68,493,261		probably benign	Het
Pkhd1	T	C	1: 20,200,868	T3154A	probably benign	Het
Ptprs	A	G	17: 56,425,534	Y438H	probably damaging	Het
Rdh8	T	A	9: 20,822,729	D70E	probably benign	Het
Scn2a	A	T	2: 65,713,767	I831L	possibly damaging	Het
Selenoo	A	G	15: 89,096,718	H420R	probably benign	Het
Slc22a16	T	C	10: 40,570,681		probably benign	Het
Slc5a1	A	G	5: 33,145,288	T208A	probably benign	Het
Sparc	T	C	11: 55,405,236	M121V	probably benign	Het
Sstr1	G	T	12: 58,213,631	A347S	probably benign	Het
Stab1	C	A	14: 31,157,445	V693F	probably benign	Het
Tnn	A	G	1: 160,145,111	V307A	probably benign	Het
Trmt1	A	G	8: 84,690,753		probably benign	Het
Ttc3	T	C	16: 94,442,901	S1255P	probably benign	Het
Ube2ql1	A	C	13: 69,739,157	S62A	unknown	Het
Vmn2r84	T	A	10: 130,385,940	M804L	probably damaging	Het
Vps13a	T	C	19: 16,640,039	T3002A	probably damaging	Het
Vps50	A	G	6: 3,562,306	E467G	probably damaging	Het

Other mutations in Mast3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00952:Mast3	APN	8	70780683	splice site	probably benign
IGL01411:Mast3	APN	8	70779583	missense	possibly damaging	0.50
IGL01475:Mast3	APN	8	70779530	missense	probably damaging	1.00
IGL01886:Mast3	APN	8	70782139	missense	possibly damaging	0.94
IGL02104:Mast3	APN	8	70787906	missense	possibly damaging	0.78
IGL02236:Mast3	APN	8	70789244	missense	probably benign	0.36
IGL02437:Mast3	APN	8	70780558	missense	possibly damaging	0.79
IGL02704:Mast3	APN	8	70786875	missense	probably damaging	1.00
IGL03155:Mast3	APN	8	70789217	missense	probably damaging	1.00
IGL03366:Mast3	APN	8	70781563	nonsense	probably null
gravy	UTSW	8	70786635	missense	probably damaging	1.00
stuffing	UTSW	8	70784797	frame shift	probably null
turkey	UTSW	8	70785482	missense	probably damaging	1.00
BB010:Mast3	UTSW	8	70786635	missense	probably damaging	1.00
BB020:Mast3	UTSW	8	70786635	missense	probably damaging	1.00
R0037:Mast3	UTSW	8	70783699	critical splice donor site	probably null
R0280:Mast3	UTSW	8	70783795	missense	probably damaging	1.00
R0280:Mast3	UTSW	8	70787920	missense	possibly damaging	0.65
R0731:Mast3	UTSW	8	70781321	missense	probably damaging	1.00
R1101:Mast3	UTSW	8	70786663	missense	probably damaging	1.00
R1177:Mast3	UTSW	8	70780324	missense	probably damaging	1.00
R1208:Mast3	UTSW	8	70788272	splice site	probably null
R1208:Mast3	UTSW	8	70788272	splice site	probably null
R1333:Mast3	UTSW	8	70781294	missense	probably damaging	1.00
R1543:Mast3	UTSW	8	70792311	missense	possibly damaging	0.93
R1544:Mast3	UTSW	8	70786172	missense	probably damaging	1.00
R1738:Mast3	UTSW	8	70784556	missense	probably benign	0.38
R1842:Mast3	UTSW	8	70780393	missense	possibly damaging	0.91
R1936:Mast3	UTSW	8	70784800	missense	probably damaging	1.00
R2015:Mast3	UTSW	8	70787363	missense	probably benign	0.00
R2219:Mast3	UTSW	8	70780963	missense	probably damaging	0.99
R2220:Mast3	UTSW	8	70780963	missense	probably damaging	0.99
R3711:Mast3	UTSW	8	70779607	missense	probably benign	0.13
R3919:Mast3	UTSW	8	70779422	missense	probably benign	0.02
R4027:Mast3	UTSW	8	70787908	missense	probably damaging	1.00
R4060:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4061:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4062:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4063:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4672:Mast3	UTSW	8	70784797	frame shift	probably null
R4770:Mast3	UTSW	8	70786220	missense	probably damaging	1.00
R4822:Mast3	UTSW	8	70780366	missense	probably damaging	1.00
R4830:Mast3	UTSW	8	70788915	missense	possibly damaging	0.87
R5196:Mast3	UTSW	8	70788245	missense	probably damaging	1.00
R5333:Mast3	UTSW	8	70783501	missense	probably benign	0.03
R5428:Mast3	UTSW	8	70784733	missense	possibly damaging	0.95
R5656:Mast3	UTSW	8	70786221	missense	probably damaging	1.00
R5920:Mast3	UTSW	8	70787933	missense	probably benign	0.00
R6177:Mast3	UTSW	8	70790018	missense	probably damaging	1.00
R6186:Mast3	UTSW	8	70785483	missense	probably damaging	1.00
R6407:Mast3	UTSW	8	70782128	missense	probably benign	0.02
R6614:Mast3	UTSW	8	70781966	missense	possibly damaging	0.95
R6804:Mast3	UTSW	8	70786732	missense	probably benign	0.29
R6873:Mast3	UTSW	8	70786592	nonsense	probably null
R6930:Mast3	UTSW	8	70799471	nonsense	probably null
R6948:Mast3	UTSW	8	70785482	missense	probably damaging	1.00
R7084:Mast3	UTSW	8	70779473	missense	probably benign	0.14
R7253:Mast3	UTSW	8	70789682	critical splice donor site	probably null
R7316:Mast3	UTSW	8	70779788	missense	probably damaging	1.00
R7357:Mast3	UTSW	8	70784859	missense	probably damaging	1.00
R7405:Mast3	UTSW	8	70786171	missense	probably damaging	1.00
R7429:Mast3	UTSW	8	70780303	missense	probably damaging	1.00
R7430:Mast3	UTSW	8	70780303	missense	probably damaging	1.00
R7521:Mast3	UTSW	8	70788768	missense	probably benign	0.16
R7576:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R7933:Mast3	UTSW	8	70786635	missense	probably damaging	1.00
R7998:Mast3	UTSW	8	70783570	missense	probably benign
R8021:Mast3	UTSW	8	70788252	missense	probably benign	0.02
R8204:Mast3	UTSW	8	70788281	missense	probably benign	0.00
R8327:Mast3	UTSW	8	70779418	missense	probably damaging	1.00
R8357:Mast3	UTSW	8	70780441	missense	probably benign	0.39
R8415:Mast3	UTSW	8	70781222	missense	probably damaging	1.00
R8457:Mast3	UTSW	8	70780441	missense	probably benign	0.39
R8530:Mast3	UTSW	8	70788233	missense	possibly damaging	0.92
R8891:Mast3	UTSW	8	70781157	missense	probably damaging	1.00
R8930:Mast3	UTSW	8	70781733	splice site	probably benign
R9002:Mast3	UTSW	8	70781260	missense	probably damaging	1.00
R9085:Mast3	UTSW	8	70796717	missense	unknown
R9087:Mast3	UTSW	8	70789686	missense	possibly damaging	0.93
R9148:Mast3	UTSW	8	70780447	missense	probably damaging	0.98
R9364:Mast3	UTSW	8	70786182	missense	probably damaging	1.00
R9779:Mast3	UTSW	8	70785483	missense	probably damaging	1.00
Z1177:Mast3	UTSW	8	70789038	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- GAGCACAGAAGATGGCTTTG -3'
(R):5'- TGACACCACGAGCCTTTTATGG -3'

Sequencing Primer
(F):5'- CACAGAAGATGGCTTTGAGATCCTC -3'
(R):5'- ATGGCTGCACCTCCTCTATC -3'

Posted On

2015-09-24