Incidental Mutation 'R4588:Atrip'
ID342623
Institutional Source Beutler Lab
Gene Symbol Atrip
Ensembl Gene ENSMUSG00000025646
Gene NameATR interacting protein
Synonyms
MMRRC Submission 042007-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4588 (G1)
Quality Score222
Status Validated
Chromosome9
Chromosomal Location109057933-109074124 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 109060279 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 20 (D20E)
Ref Sequence ENSEMBL: ENSMUSP00000118499 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026737] [ENSMUST00000045011] [ENSMUST00000061973] [ENSMUST00000112053] [ENSMUST00000112059] [ENSMUST00000128062] [ENSMUST00000154184] [ENSMUST00000159614] [ENSMUST00000160217] [ENSMUST00000161521] [ENSMUST00000198295] [ENSMUST00000198376] [ENSMUST00000197689] [ENSMUST00000200515] [ENSMUST00000197483] [ENSMUST00000200629] [ENSMUST00000198708] [ENSMUST00000197099] [ENSMUST00000196954]
Predicted Effect probably benign
Transcript: ENSMUST00000026737
SMART Domains Protein: ENSMUSP00000026737
Gene: ENSMUSG00000025647

DomainStartEndE-ValueType
low complexity region 11 22 N/A INTRINSIC
Pfam:Shisa 24 211 1.3e-59 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000045011
AA Change: D758E

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000044831
Gene: ENSMUSG00000025646
AA Change: D758E

DomainStartEndE-ValueType
SCOP:d1eq1a_ 96 193 8e-3 SMART
low complexity region 326 338 N/A INTRINSIC
low complexity region 542 548 N/A INTRINSIC
low complexity region 555 566 N/A INTRINSIC
low complexity region 598 609 N/A INTRINSIC
low complexity region 761 779 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000061973
SMART Domains Protein: ENSMUSP00000050971
Gene: ENSMUSG00000049734

DomainStartEndE-ValueType
EXOIII 13 217 2.45e-13 SMART
low complexity region 248 283 N/A INTRINSIC
transmembrane domain 287 309 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112053
SMART Domains Protein: ENSMUSP00000107684
Gene: ENSMUSG00000049734

DomainStartEndE-ValueType
EXOIII 13 217 2.45e-13 SMART
low complexity region 248 283 N/A INTRINSIC
transmembrane domain 287 309 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112059
SMART Domains Protein: ENSMUSP00000107690
Gene: ENSMUSG00000025647

DomainStartEndE-ValueType
low complexity region 11 22 N/A INTRINSIC
Pfam:Shisa 26 198 1.1e-48 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000128062
AA Change: D20E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000118499
Gene: ENSMUSG00000025646
AA Change: D20E

DomainStartEndE-ValueType
PDB:3MXJ|A 1 150 4e-97 PDB
SCOP:d1fxxa_ 12 146 7e-12 SMART
Blast:EXOIII 13 150 1e-85 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000154184
SMART Domains Protein: ENSMUSP00000128901
Gene: ENSMUSG00000025647

DomainStartEndE-ValueType
Pfam:Shisa 1 108 1.6e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159614
SMART Domains Protein: ENSMUSP00000124854
Gene: ENSMUSG00000025646

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 54 60 N/A INTRINSIC
low complexity region 67 78 N/A INTRINSIC
low complexity region 110 121 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160217
SMART Domains Protein: ENSMUSP00000125264
Gene: ENSMUSG00000025646

DomainStartEndE-ValueType
SCOP:d1eq1a_ 96 193 3e-3 SMART
low complexity region 326 338 N/A INTRINSIC
low complexity region 533 550 N/A INTRINSIC
low complexity region 570 581 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160928
SMART Domains Protein: ENSMUSP00000123837
Gene: ENSMUSG00000025646

DomainStartEndE-ValueType
SCOP:d1eq1a_ 19 116 9e-3 SMART
low complexity region 249 261 N/A INTRINSIC
low complexity region 465 471 N/A INTRINSIC
low complexity region 478 489 N/A INTRINSIC
low complexity region 521 532 N/A INTRINSIC
low complexity region 684 702 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161163
Predicted Effect probably damaging
Transcript: ENSMUST00000161521
AA Change: D731E

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125615
Gene: ENSMUSG00000025646
AA Change: D731E

DomainStartEndE-ValueType
coiled coil region 108 208 N/A INTRINSIC
low complexity region 326 338 N/A INTRINSIC
low complexity region 542 548 N/A INTRINSIC
low complexity region 555 566 N/A INTRINSIC
low complexity region 598 609 N/A INTRINSIC
low complexity region 734 752 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197194
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198591
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198639
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199288
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200366
Predicted Effect probably benign
Transcript: ENSMUST00000198295
SMART Domains Protein: ENSMUSP00000143721
Gene: ENSMUSG00000025647

DomainStartEndE-ValueType
Pfam:Shisa 1 70 1.3e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000198376
SMART Domains Protein: ENSMUSP00000143374
Gene: ENSMUSG00000025647

DomainStartEndE-ValueType
Pfam:Shisa 1 83 5e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197689
SMART Domains Protein: ENSMUSP00000142874
Gene: ENSMUSG00000025647

DomainStartEndE-ValueType
Pfam:Shisa 1 63 4.3e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200515
SMART Domains Protein: ENSMUSP00000142835
Gene: ENSMUSG00000025647

DomainStartEndE-ValueType
Pfam:Shisa 11 147 4.1e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197483
SMART Domains Protein: ENSMUSP00000143613
Gene: ENSMUSG00000025647

DomainStartEndE-ValueType
Pfam:Shisa 1 95 1.9e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199868
Predicted Effect probably benign
Transcript: ENSMUST00000200629
SMART Domains Protein: ENSMUSP00000142404
Gene: ENSMUSG00000025647

DomainStartEndE-ValueType
Pfam:Shisa 1 72 1.9e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000198708
SMART Domains Protein: ENSMUSP00000142978
Gene: ENSMUSG00000025647

DomainStartEndE-ValueType
Pfam:Shisa 1 109 7.8e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197099
SMART Domains Protein: ENSMUSP00000143648
Gene: ENSMUSG00000025647

DomainStartEndE-ValueType
Pfam:Shisa 1 129 9.9e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196954
SMART Domains Protein: ENSMUSP00000143599
Gene: ENSMUSG00000025647

DomainStartEndE-ValueType
Pfam:Shisa 1 95 1.9e-30 PFAM
Meta Mutation Damage Score 0.2030 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an essential component of the DNA damage checkpoint. The encoded protein binds to single-stranded DNA coated with replication protein A. The protein also interacts with the ataxia telangiectasia and Rad3 related protein kinase, resulting in its accumulation at intranuclear foci induced by DNA damage. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 G T 10: 79,997,867 probably null Het
Abcb4 A T 5: 8,947,328 I936F probably benign Het
Adnp2 G T 18: 80,128,648 L849I probably benign Het
Atf7ip T C 6: 136,599,694 S1032P probably benign Het
Atr A C 9: 95,865,667 D334A probably benign Het
Atxn7 T A 14: 14,096,268 C43* probably null Het
Cfap65 C A 1: 74,904,056 Q1603H possibly damaging Het
Cpne5 T C 17: 29,164,713 I327V probably benign Het
Ctsa T C 2: 164,834,150 S41P possibly damaging Het
Cyp4x1 A T 4: 115,108,797 L444Q probably damaging Het
Dchs1 C A 7: 105,756,041 M2431I probably benign Het
Ddi1 T A 9: 6,266,003 H122L probably benign Het
Defa21 C T 8: 21,025,648 P21S probably damaging Het
Ect2 A G 3: 27,147,000 V77A probably damaging Het
Ermap C A 4: 119,188,248 probably benign Het
Fancm G A 12: 65,118,441 probably null Het
Gcnt3 T A 9: 70,034,230 D352V probably damaging Het
Gys2 A G 6: 142,449,455 M428T possibly damaging Het
Igtp T A 11: 58,206,682 N226K probably damaging Het
Itpr2 T A 6: 146,241,196 H1675L probably benign Het
Lipo4 G A 19: 33,499,247 P367L possibly damaging Het
Lzts3 T C 2: 130,634,766 *587W probably null Het
Mast3 T A 8: 70,780,607 K300* probably null Het
Mepce G A 5: 137,785,272 T264I possibly damaging Het
Mif4gd A T 11: 115,609,546 I62N probably damaging Het
Olfr307 C T 7: 86,335,644 V251I probably benign Het
Olfr869 T A 9: 20,138,087 *324K probably null Het
Palm3 A G 8: 84,029,386 K509R probably benign Het
Pde11a T C 2: 76,029,303 T821A probably damaging Het
Pik3r5 A G 11: 68,493,261 probably benign Het
Pkhd1 T C 1: 20,200,868 T3154A probably benign Het
Ptprs A G 17: 56,425,534 Y438H probably damaging Het
Rdh8 T A 9: 20,822,729 D70E probably benign Het
Scn2a A T 2: 65,713,767 I831L possibly damaging Het
Selenoo A G 15: 89,096,718 H420R probably benign Het
Slc22a16 T C 10: 40,570,681 probably benign Het
Slc5a1 A G 5: 33,145,288 T208A probably benign Het
Sparc T C 11: 55,405,236 M121V probably benign Het
Sstr1 G T 12: 58,213,631 A347S probably benign Het
Stab1 C A 14: 31,157,445 V693F probably benign Het
Tnn A G 1: 160,145,111 V307A probably benign Het
Trmt1 A G 8: 84,690,753 probably benign Het
Ttc3 T C 16: 94,442,901 S1255P probably benign Het
Ube2ql1 A C 13: 69,739,157 S62A unknown Het
Vmn2r84 T A 10: 130,385,940 M804L probably damaging Het
Vps13a T C 19: 16,640,039 T3002A probably damaging Het
Vps50 A G 6: 3,562,306 E467G probably damaging Het
Other mutations in Atrip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01348:Atrip APN 9 109069295 missense probably damaging 1.00
IGL02176:Atrip APN 9 109067046 missense probably benign 0.06
IGL02227:Atrip APN 9 109061664 missense possibly damaging 0.86
IGL02344:Atrip APN 9 109072624 nonsense probably null
IGL02406:Atrip APN 9 109065419 missense probably damaging 0.99
IGL02457:Atrip APN 9 109065231 missense possibly damaging 0.95
IGL02823:Atrip APN 9 109061178 missense probably damaging 1.00
PIT4508001:Atrip UTSW 9 109073989 missense possibly damaging 0.93
R0637:Atrip UTSW 9 109061173 missense possibly damaging 0.58
R0709:Atrip UTSW 9 109067103 missense probably benign 0.00
R1452:Atrip UTSW 9 109072659 missense probably damaging 1.00
R1944:Atrip UTSW 9 109071867 missense probably damaging 1.00
R1945:Atrip UTSW 9 109071867 missense probably damaging 1.00
R2081:Atrip UTSW 9 109072739 critical splice acceptor site probably null
R5032:Atrip UTSW 9 109065203 missense probably benign 0.02
R5088:Atrip UTSW 9 109059896 missense probably damaging 0.97
R5696:Atrip UTSW 9 109065501 missense possibly damaging 0.59
R6104:Atrip UTSW 9 109065564 missense possibly damaging 0.94
R6136:Atrip UTSW 9 109071736 missense probably damaging 1.00
R7071:Atrip UTSW 9 109067014 splice site probably null
R7131:Atrip UTSW 9 109060420 missense probably benign
R7467:Atrip UTSW 9 109069354 missense probably damaging 1.00
R7734:Atrip UTSW 9 109065506 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- AGCGAGGCCAATTCAATAGAC -3'
(R):5'- CGCTCACTGTGATGTTGCAC -3'

Sequencing Primer
(F):5'- GAGGCCAATTCAATAGACACCATC -3'
(R):5'- GCAATGGCTGACGGTGC -3'
Posted On2015-09-24